Pilosocereus fulvilanatus

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records81

Data sources7

Biological traits12

DNA specimens2

eDNA detections0

Sources7 archives

Databases and archives Pilosocereus fulvilanatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility81 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF81 records

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Pilosocereus fulvilanatus is a species of plant in the family Cactaceae. It is endemic to Brazil. Its natural habitats are subtropical or tropical dry forests, subtropical or tropical dry shrubland, and rocky areas. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max4 m

Life cycle & reproduction2

Life formsucculent shrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyte detailedterrestrial

Growth formtree

Habitat GIFTCampo Rupestre, Carrasco

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus fulvilanatus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOP188772.1 ↗466 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCCGCCGCGCCCGGCCGC …

Pilosocereus fulvilanatus isolate S42A2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type81 records

Wild obs. + sensor57

Museum / vouchered24

Origin

Native11

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 57

57 georeferenced

Open the mapobservation + sensor57

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	4
Kew, GB	4
UFSCarlocation not on record	4
USP-IBlocation not on record	4
JBRJlocation not on record	3
UFMGlocation not on record	3
San Jose State University, Museum of Birds and Mammalslocation not on record	2

7 institutions · 24 of 24 vouchered records shown