Pilosocereus chrysacanthus

(F.A.C.Weber ex K.Schum.) Byles & G.D.Rowley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records231

Data sources11

Biological traits6

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Pilosocereus chrysacanthus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility231 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionNPASS11 compounds

Occurrence & distributionGBIF231 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Pilosocereus chrysacanthus ist eine Pflanzenart in der Gattung Pilosocereus aus der Familie der Kakteengewächse (Cactaceae). Das Artepitheton chrysacanthus bedeutet ‚goldgelbstachelig‘.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatedesert or dry shrubland

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition11 compounds

Compounds documented for Pilosocereus chrysacanthus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids5

Isoquinoline alkaloids $ Protoberberine alkaloids4

Aporphine alkaloids $ Isoquinoline alkaloids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Berbamine	present	NPASS
(+)-Magnoflorine	present	NPASS
(1S,14R)-20,21,25-trimethoxy-15,30-dimethyl-8,23-dioxa-15,30-diazaheptacyclo[22.6.2.29,12.13,7.114,18.027,31.022,33]hexatriaconta-3(36),4,6,9(35),10,12(34),18,20,22(33),24,26,31-dodecaen-6-ol	present	NPASS
2,9,10-trimethoxy-6,7-dihydro-5H-isoquinolino[2,1-b]isoquinolin-7-ium-3-one	present	NPASS
Aromoline	present	NPASS
Berberine	present	NPASS
Columbamine	present	NPASS
Isotetrandrine, (+)-	present	NPASS
Oxyacanthine	present	NPASS
Palmatine	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus chrysacanthus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

matKFN997245.1 ↗2 066 bpMexico

ACGT

GTGCGGCTAGGATCTTTTACATATTTGGATGAAGCAAGGAATTCGTCTACATCATCGGTAGAGTTTATCAGACCACGACTGATCCTGAAA …

Pilosocereus chrysacanthus chloroplast matK gene and partial tRNA-Lys intron, specimen voucher MEXU H1094

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Pilosocereus chrysacanthus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Katagiri 1952

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type231 records

Wild obs. + sensor152

Museum / vouchered78

Other1

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 84≤1 km 21≤10 km 10>10 km 7

122 georeferenced · 30 without coordinates

Open the mapobservation + sensor152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 53≤10 km 4

57 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	40
University of Stellenboschlocation not on record	10
Tlalnepantla, MX	7
Chicago, US	1
JBRJlocation not on record	1
Bronx, US	1
Mexico City, MX	1

7 institutions · 61 of 78 vouchered records shown · 15 without an institution code

09Environmental DNA3 detections

Where the DNA of Pilosocereus chrysacanthus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)