Pilosocereus catingicola

(Gürke) Byles & G.D.Rowley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records143

Data sources9

Biological traits12

DNA specimens2

eDNA detections0

Sources9 archives

Databases and archives Pilosocereus catingicola's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility143 records↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF143 records

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Pilosocereus catingicola is a flowering plant in the family Cactaceae that is endemic in northeastern Brazilian states of Rio Grande do Norte, Pernambuco, Alagoas, Sergipe, Paraíba, Bahia.Zappi, D.; Taylor, N.P. 2020. Cactaceae in Flora do Brasil 2020. Jardim Botânico do Rio de Janeiro. Access date:2021-06-01 The plant is bat-pollinated, by Goldman's nectar bat.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max10 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTCaatinga (stricto sensu), Carrasco, Floresta Estacional Decidual, Restinga

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus catingicola has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMT304104.1 ↗1 384 bp

ACGT

AGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTAACTATCAACCCCAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCC …

Pilosocereus catingicola isolate NE063 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK1★rbcL1

animal barcodeplant barcode

06Genome at a glanceCCDB

The complete instruction manual Pilosocereus catingicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome records44–442n range44median44mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 30

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type143 records

Wild obs. + sensor25

Museum / vouchered118

Origin

Native57

Range

Area of Occupancy AOO436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 6≤1 km 6≤10 km 2

14 georeferenced · 11 without coordinates

Open the mapobservation + sensor25

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 118 records without

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratorio de Ictiologialocation not on record	17
Universidade Federal do Rio Grande do Nortelocation not on record	16
Universidade Federal do Ceara, Departamento de Biologialocation not on record	14
Fortaleza, BR	10
Kew, GB	8
Cruz das Almas, BR	7
Bronx, US	5
UFBAlocation not on record	5
Departamento de Sistematica e Ecologialocation not on record	5
Universidade Federal do Vale do São Franciscolocation not on record	4
UFPElocation not on record	3
UnBlocation not on record	3
JBRJlocation not on record	3
Salvador, BR	3
UFSCarlocation not on record	2
Universidade Federal do Maranhãolocation not on record	2
Feira de Santana, BR	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
URCAlocation not on record	2
USP-IBlocation not on record	1
UFRPElocation not on record	1
Chaguaramas, TT	1
Universidade Federale do Rio Grande do Sullocation not on record	1

23 institutions · 117 of 118 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)