Pilosocereus azulensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records6

Data sources7

Biological traits12

DNA specimens1

eDNA detections0

Sources7 archives

Databases and archives Pilosocereus azulensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF6 records

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pilosocereus azulensis is a species of plant in the family Cactaceae. It is endemic to Brazil. Its natural habitat is subtropical or tropical dry forests. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height max4 m

Life cycle & reproduction2

Life formsucculent shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTCaatinga (stricto sensu), Floresta Estacional Decidual

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus azulensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOP188782.1 ↗472 bp

ACGT

CGGGGGGCAACCCCCGGCGCAGCAACGAAACCCCGGCGCGAACCGCGCCAAGGAACACGAACTCATGGCGTGCCCGCCCGCGCCCGGCCC …

Pilosocereus azulensis isolate S77A9 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5PITS1

animal barcodefungal barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor1

Museum / vouchered5

Origin

Native2

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFSCarlocation not on record	2
Kew, GB	1
Departamento de Sistematica e Ecologialocation not on record	1
JBPlocation not on record	1

4 institutions · 5 of 5 vouchered records shown