Pilosocereus alensis

(F.A.C.Weber ex Rol.-Goss.) Byles & G.D.Rowley · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Cactaceae/Pilosocereus

At a glance

Occurrence records287

Data sources9

Biological traits6

DNA specimens1

eDNA detections2

Sources9 archives

Databases and archives Pilosocereus alensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility287 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Chemical compositionNPASS5 compounds

Occurrence & distributionGBIF287 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pilosocereus alensis, the Sonoran old man cactus, is a species of cactus native to Western Mexico, from Sonora south to Jalisco. The hairs protect the flower buds. Flowers open at night in June and give off the odor of ammonia, attracting bats for pollination. The juicy fruit is tasty.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatedesert or dry shrubland

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Pilosocereus alensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Laurane sesquiterpenoids2

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
2,2-Dichloroacetamide	present	NPASS
4-Bromo-2-[(1R,3S)-1,3-dimethyl-2-methylenecyclopentyl]-5-methylphenol	present	NPASS
ASODNZCPFZQUKR-UHFFFAOYSA-N	present	NPASS
BWXKGZVAOLOFJU-UHFFFAOYSA-N	present	NPASS
Laurinterol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosocereus alensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW374734.1 ↗451 bpMexico

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Pilosocereus alensis voucher OAX:47122 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type287 records

Wild obs. + sensor240

Museum / vouchered47

Range

Area of Occupancy AOO744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 116≤1 km 42≤10 km 17>10 km 8

183 georeferenced · 57 without coordinates

Open the mapobservation + sensor240

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 20≤1 km 3≤10 km 8

31 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence47

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zapopan, MX	12
Guasave, MX	10
Bronx, US	7
University of Stellenboschlocation not on record	6
Mexico City, MX	4
Phoenix, US	2
Durango, MX	1
ASUlocation not on record	1
San Diego, US	1

9 institutions · 44 of 47 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Pilosocereus alensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 15.7–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C

Min temp (night)9.00 °C

Precipitation34.7 mm/mo

Air humidity50.9 %

Moisture balance-93.3 mm/mo

Vapour deficit884 Pa

Wind speed4.10 m/s

Cloud cover25.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)