Pilosella officinarum
Vaill. · speciesAt a glance
Occurrence records125 959
Data sources13
Biological traits62
DNA specimens72
eDNA detections40
Sources13 archives
Databases and archives Pilosella officinarum's data was compiled from.
WikipediaWikimedia Foundation11 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility125 959 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics72 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources62 traits
Chemical compositionNPASS8 compounds
Occurrence & distributionGBIF125 959 records
Environmental DNA1 datasets · 10 countries40 detections
DNA & barcodingBOLD · NCBI72 specimens
Genome at a glanceCCDB · GoaT4.5 Gbp
01Narrative
Das Kleine Habichtskraut (Hieracium pilosella), auch Mausohr-Habichtskraut oder Langhaariges Habichtskraut genannt, ist eine Pflanzenart aus der Gattung der Habichtskräuter (Hieracium) innerhalb der Familie der Korbblütler (Asteraceae).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology23
Leaf length max38 mm
Leaf length min2.5 mm
Leaf mass4.22 mg
Leaf size185 mm²
⚠ sources differ — TRY: 185 mm² · LEDA: 86 mm² · GIFT: 86 mm²
Leaf width10 mm
Leaf width max12 mm
Leaf width min0.4 mm
Plant height0.06 m
⚠ sources differ — GIFT: 0.06 m · LEDA: 0.06 m · TRY: 0.034 m
Plant height generative0.124 m
Plant height max0.4 m
Plant height min0.02 m
Seed length2 mm
Seed length max2 mm
Seed length min2 mm
Seed mass0.159 mg
⚠ sources differ — TRY: 0.159 mg · LEDA: 0.152 mg · GIFT: 0.218 mg
Seed mass max0.27 mg
Seed mass min0.1 mg
Seed volume0.17 mm³
Seed volume max0.17 mm³
Seed volume min0.17 mm³
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction14
DeciduousnessDeciduous
⚠ sources differ — TRY: Deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endJul
Flowering startMay
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Seed number66.4
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTmountains, stony places
Mycorrhizaabsent
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio28.12 g/g
Leaf c446 mg/g
Leaf dry-matter content (LDMC)215 mg/g
⚠ sources differ — TRY: 215 mg/g · LEDA: 188 mg/g
Leaf n17.36 mg/g
Leaf p1.71 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)8.92 mm²/mg
⚠ sources differ — TRY: 8.92 mm²/mg · LEDA: 17.7 mm²/mg · GIFT: 19.1 mm²/mg
Other traits1
Diaspore typegerminule
03Chemical composition8 compounds
Compounds documented for Pilosella officinarum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Depsides3
Simple phenolic acids2
Shikimic acids and derivatives $ Simple phenolic acids1
Usnic acid and derivatives1
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Usnic Acid | present | NPASS | |
| Atranorin | present | NPASS | |
| Divaricatic acid | present | NPASS | |
| Lecanoric Acid | present | NPASS | |
| Methyl Haematommate | present | NPASS | |
| Methyl Orsellinate | present | NPASS | |
| Orcinol | present | NPASS | |
| Orsellinic Acid | present | NPASS |
05DNA & barcoding72 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosella officinarum has left across the world's sequence archives.
At a glance
DNA specimens72
Marker genes10
GenBank sequences10
eDNA detections40
Countries10
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCC …
Pilosella officinarum voucher PLT.0624 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★trnL-F★ITS4★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Pilosella officinarum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 547 700 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Pilosella officinarum4.55 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy2× / 6× cytotypes
Chromosome records18–902n range36median36mode133records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3679×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +11
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · ita-fl — GADELLA T.W.J. - 1972. Biosystematic studies in Hieracium pilosella L. and some related species of the subgenus Pilosella.. Bot. Not. , 125: 361-369.
CCDB · slov-fl — Píšťanský J. & Mičieta K., 2000: Príspevok ku karyogeografickému štúdiu Pilosella officinarum agg. na Slovensku. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 57-64.
CCDB · slov-fl — Mičieta K., 1982: Zytotaxonomischer Beitrag zur Flora des Javorníky-Gebirges II. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 55-61.
CCDB · slov-fl — Murín A., 1986: Karyological study of the Slovak flora XVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 85-92.
CCDB · brit-fl — Moore, D.M. (1982)
CCDB · brit-fl — Finch, R. ()
CCDB · brit-fl — Turesson, B. Bot. Not. 125: 223-240 (1972)
CCDB · brit-fl — Watson, P.M. (1969)
CCDB · brit-fl — Edmonds, J.M., Sell, P.D., Walters, S.M. (1973)
CCDB · brit-fl — Gadella, T.W.J. Bot. Not. 125: 361-369 (1972)
CCDB · brit-fl — Turesson, G., Turesson, B. Hereditas (Lund) 46: 717-736 (1960)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · hieracium — Rosenberg 1917; Christoff & Popoff 1933; Turesson & Turesson 1960; Gadella & Kliphuis 1966; Gadella, T.W.J. & Kliphuis, E. 1968c; Gadella, T.W.J. & Kliphuis, E. 1970; Gadella et al. 1970; Gadella & Kliphuis 1971; Skalinska, Pogan et al. 1971; Delcourt 1972; Dmitrieva et al. 1977; Hommel & Wiefering 1979; Gadella 1981; Natarajan 1981; Micieta 1982; Pogan et al. 1983; Gadella 1984; Jalas & Pellinen 1985; Uotila & Pellinen 1985; Dmitrieva 1987; Gadella 1987; Pashuk 1987; Pogan et al. 1987; Gadella 1988; Parfenov & Dmitrieva 1988; Hill 1989; Pogan & Wcislo 1989; Pogan & Wcislo 1990; Gadella 1991; Mes?cek & Jarol?mov? 1992
CCDB · hieracium — D.M. Moore 1982
CCDB · hieracium — G. & B. Turesson 1960; Fernandes & Queiros 1971; Natarajan 1988
CCDB · hieracium — Finch ined. in D.M. Moore 1982
CCDB · fl-europaea — Gadella & Kliphuis
CCDB · fl-europaea — G. & B. Turesson,
CCDB · fl-europaea — Finch, ined.
CCDB · ipcn-api-dl — Mikcieta, K. 1982. Zytotaxonomischer Beitrag zur Flora des Javornaiky-Gebirges II. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 29: 55–61.
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Krahulcová, A. & F. Krahulec. 1999. Chromosome numbers and reproductive systems in selected representatives of Hieracium subgen. Pilosella in the Krkonoae Mts (the Sudeten Mts). Preslia 71: 217–234.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Natarajan, G. 1981. In Chromosome number reports LXXII. Taxon 30: 698–699.
CCDB · ipcn-api-dl — Gadella, T. W. J. 1981. Het Schellings havikskruid (Hieracium peleterianum Merat). Gorteria 10: 120–129.
CCDB · ipcn-api-dl — Makepeace, W. 1981. Polymorphism and the chromosomal number of Hieracium pilosella L. in New Zealand. New Zealand J. Bot. 19: 255–258.
CCDB · ipcn-api-dl — Schuhwerk, F. & W. Lippert. 2002. Chromosomenzahlen von Hieracium (Compositae, Lactuceae) Teil 4. Sendtnera 8: 167–194.
CCDB · ipcn-api-dl — Krahulcová, A. & F. Krahulec. 2000. Offspring diversity in Hieracium subgen. Pilosella (Asteraceae): new cytotypes from hybridization experiments and from open pollination. Fragm. Florist. Geobot. 45(1–2): 239–255.
CCDB · ipcn-api-dl — Dmitrieva, S. A., V. I. Parfenov & I. V. SCHVEC. 1977. The karyological characterization of some species of the Belorussian flora. Vesci Akad. Navuk Belarusk SSR Ser. Bi jal. Sel'skagasp. Navuk. 19: 82–91.
CCDB · ipcn-api-dl — Krahulec, F. 2004. The Sudetic group of Hieracium subgen. Pilosella from the Krkonoae Mts: a synthetic view. Preslia 76(3): 223–243.
CCDB · ipcn-api-dl — Nazarova. 2004. Pages 1--171 in Chromosome Numbers of Flowering Plants of Armenian Flora. Yerevan.
+10 more references
2n 4549×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — GADELLA T.W.J. - 1972. Biosystematic studies in Hieracium pilosella L. and some related species of the subgenus Pilosella.. Bot. Not. , 125: 361-369.
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · slov-fl — Rotreklová O., Krahulcová A., Vaňková D., Peckert T. & Mráz P., 2002: Chromosome numbers and breeding systems in some species of Hieracium subgen. Pilosella from Central Europe. - Preslia 74/1: 27-44.
CCDB · slov-fl — Píšťanský J. & Mičieta K., 2000: Príspevok ku karyogeografickému štúdiu Pilosella officinarum agg. na Slovensku. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 57-64.
CCDB · slov-fl — Uhríková A. & Feráková V., 1977: [Report], pp. 263. - In: Löve Á. (ed.), IOPB Chromosome number reports LVI, Taxon 26 /2-3.
CCDB · slov-fl — Rotreklová O., Krahulcová A., Mráz P., Mrázová V., Mártonfiová L., Peckert T. & Šingliarová B., 2005: Chromosome numbers and breeding systems of some European species of Hieracium subgen. Pilosella. - Preslia 77/2: 177-195.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Moore, D.M. (1982)
CCDB · brit-fl — Watson, P.M. (1969)
CCDB · brit-fl — Finch, R. ()
CCDB · brit-fl — Gadella, T.W.J. Bot. Not. 125: 361-369 (1972)
CCDB · brit-fl — Grime, J.P., Hodgson, J.C., Hunt, R. (1988)
CCDB · hieracium — Christoff & Popoff 1933; Gentcheff 1937a; Turesson & Turesson 1960; Gadella & Kliphuis 1963; Gadella & Kliphuis 1968c; Skalinska 1968; Gadella, T.W.J. & Kliphuis, E. 1970; Gadella, T.W.J. & Kliphuis, E. 1970a; Gadella et al. 1970; Gadella & Kliphuis 1971; Skalinska, Pogan et al. 1971; Delcourt 1972; Gadella 1972; Uhr?kov? & Ferakova 1977; Gadella 1981; Makepeace 1981; Gadella 1984; Jalas & Pellinen 1985; Gadella 1987; Pogan et al. 1987; Gadella 1988; Pogan & Wcis_o 1989; Pogan & Wcis_o 1990; Gadella 1991; S. & E. Br?utigam 1996
CCDB · hieracium — Finch ined. in D.M. Moore 1982
CCDB · hieracium — D.M. Moore 1982
CCDB · hieracium — Gadella & Kliphuis 1968
CCDB · hieracium — B. Turesson 1972
CCDB · fl-europaea — Gadella, 1972
CCDB · fl-europaea — B. Turesson, 1972
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Hommel, P. W. F. M. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 277–278.
CCDB · ipcn-api-dl — Uhrikova, A. & V. Ferakova. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · book-ipcn67-71 — SKALINSKA, M. 1968. Cytological analysis of some Hieracium species, subg. Pilosella from mountains of southern Poland. Acta Biol. Cracov. Ser. Bot. 10: 127-142.
CCDB · book-ipcn67-71 — GADELLA, Th. W.J., & E. KLIPHUIS. 1968. Een Merkwaardige Vorm van Hieracium pilosella L. Gevonden bij Winterswijk. Gorteria 4(5): 57-60.
CCDB · book-fedorov — Gentscheff 1937a, 1938
CCDB · book-fedorov — Rohweder 1937
CCDB · kew — Suda J, Krahulcova A, Travnicek P, Rosenbaumova R, Peckert T, Krahulec F. 2007. Genome size variation and species relationships in Hieracium sub-genus Pilosella (Asteraceae) as inferred by flow cytometry. Annals of Botany 100: 1323-1335.
CCDB · iapt — IAPT/IOPB Chromosome Data 25
2n 5436×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J. - 1984. Cytology and the mode of reproduction of some taxa of Hieracium subgenus Pilosella. Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen: Series C: Biological and Medi , 87: 387-399.
CCDB · ita-fl — GADELLA T.W.J. - 1972. Biosystematic studies in Hieracium pilosella L. and some related species of the subgenus Pilosella.. Bot. Not. , 125: 361-369.
CCDB · ita-fl — SCANNERINI S. - 1971. Numeri cromosomici per la flora italiana:33-34.. Inform. Bot. Ital. , 3(1): 67-71.
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Rotreklová O., Krahulcová A., Vaňková D., Peckert T. & Mráz P., 2002: Chromosome numbers and breeding systems in some species of Hieracium subgen. Pilosella from Central Europe. - Preslia 74/1: 27-44.
CCDB · slov-fl — Píšťanský J. & Mičieta K., 2000: Príspevok ku karyogeografickému štúdiu Pilosella officinarum agg. na Slovensku. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 57-64.
CCDB · slov-fl — Rotreklová O., Krahulcová A., Mráz P., Mrázová V., Mártonfiová L., Peckert T. & Šingliarová B., 2005: Chromosome numbers and breeding systems of some European species of Hieracium subgen. Pilosella. - Preslia 77/2: 177-195.
CCDB · brit-fl — Morton, J.K. Watsonia 10: 169 (1974)
CCDB · brit-fl — Finch, R. ()
CCDB · brit-fl — Watson, P.M. (1969)
CCDB · brit-fl — Gadella, T.W.J. Bot. Not. 125: 361-369 (1972)
CCDB · hieracium — Turesson & Turesson 1960; Gadella, T.W.J. & Kliphuis, E. 1970; Gadella, T.W.J. & Kliphuis, E. 1970a; Gadella et al. 1970; M?jovsk? et al. 1970 (sub. Pilosella o. ); Gadella & Kliphuis 1971; Scannerini 1971; Gadella 1972; Gadella & Kliphuis 1972; Gadella 1981; Gadella 1984; Gadella 1987; Gadella 1988; Pogan & Wcis_o 1989; Gadella 1991; Lavrenko & Serditov 1991
CCDB · hieracium — Morton 1974
CCDB · hieracium — D.M. Moore 1982
CCDB · fl-europaea — Scannerini, 1971
CCDB · mediterranean
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · book-ipcn67-71 — SCANNERINI, S. 1971. In Numeri cromosomici per la flora Italiana. Inf. Bot. Italiano 3: Q7-9Q.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn73-74 — MORTON, J.K. 1974. Chromosome numbers of British plants, 3. Watsonia 10: 169.
CCDB · book-fedorov — Uhrikova, Murin
CCDB · book-fedorov — I. Slov. fl. I. 1967)
CCDB · kew — Suda J, Krahulcova A, Travnicek P, Rosenbaumova R, Peckert T, Krahulec F. 2007. Genome size variation and species relationships in Hieracium sub-genus Pilosella (Asteraceae) as inferred by flow cytometry. Annals of Botany 100: 1323-1335.
CCDB · iapt — IAPT/IOPB Chromosome Data 29
2n 1813×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +6
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J. - 1972. Biosystematic studies in Hieracium pilosella L. and some related species of the subgenus Pilosella.. Bot. Not. , 125: 361-369.
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Cytotaxonomic investigations in some Angiosperms collected in the valley of Aosta and in the National Park Gran Paradiso.. Caryologia , 23(3): 363-379.
CCDB · brit-fl — Bishop, G.F., Davy, A.J. J. Ecol. 82: 101-111 (1994)
CCDB · hieracium — Gadella & Kliphuis 1970; Delcourt 1972; Gadella 1981; Gadella 1984; Gadella 1987; Gadella 1991
CCDB · hieracium — D.M. Moore 1982
CCDB · fl-europaea — Gadella & Kliphuis
CCDB · ipcn-api-dl — Daniela, I. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 13–14.
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 635×CCDB · hieracium · CCDB · fl-europaea · CCDB · kew +1
CCDB · hieracium — Turesson & Turesson 1960; Gadella 1981; Gadella 1987; Gadella 1988; Gadella 1991
CCDB · hieracium — D.M. Moore 1982
CCDB · fl-europaea — G. & B. Turesson,
CCDB · kew — Suda J, Krahulcova A, Travnicek P, Rosenbaumova R, Peckert T, Krahulec F. 2007. Genome size variation and species relationships in Hieracium sub-genus Pilosella (Asteraceae) as inferred by flow cytometry. Annals of Botany 100: 1323-1335.
CCDB · iapt — IAPT/IOPB Chromosome Data 25
2n 722×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Gadella, T. W. J. 1976. Enige aanvullingen op de flora van Vlieland. Gorteria 8: 51–54.
CCDB · book-ipcn75-78 — Gadella 1976
2n 271×CCDB · hieracium
CCDB · hieracium — Delcourt 1972
2n 351×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
2n 371×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
2n 421×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 25
2n 481×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rotreklová, O., A. Krahulcová, D. Vaňková, T. Peckert & P. Mráz. 2002. Chromosome numbers and breeding systems in some species of Hieracium subgen. Pilosella from central Europe. Preslia 74: 27–44.
2n 531×GoaT · DTOL Flowering Plants Estimates Kew
GoaT · DTOL Flowering Plants Estimates Kew
2n 811×CCDB · hieracium
CCDB · hieracium — Gadella 1987
2n 901×CCDB · hieracium
CCDB · hieracium — Gadella 1987
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type125 959 records
Wild obs. + sensor105 185
Museum / vouchered18 681
Cultivated / captive348
Other1 745
Origin
Native57
Introduced44
Range
Area of Occupancy AOO181 820 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 31 025≤1 km 16 074≤10 km 37 192>10 km 562
84 853 georeferenced · 20 332 without coordinates
Open the mapobservation + sensor105 185
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 1 145≤1 km 4 806≤10 km 10 832>10 km 184
16 967 georeferenced · 1 714 without coordinates
Open the institutions mapphysical evidence18 681
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 347 without coordinates
Open the mapnot free-living348
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions30 of 77 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 15 409 |
| BRNUlocation not on record | 609 |
| BIO-UNIPIlocation not on record | 499 |
| Moscow State Universitylocation not on record | 466 |
| SLU Artdatabankenlocation not on record | 239 |
| Christchurch, NZ | 225 |
| Oskarshamn, SE | 218 |
| València, ES | 165 |
| LDlocation not on record | 118 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 65 |
| CJBGlocation not on record | 51 |
| Chapel Hill, US | 49 |
| Berlin, DE | 42 |
| BClocation not on record | 37 |
| DBF-NHMDlocation not on record | 36 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 33 |
| Auckland, NZ | 24 |
| BDBClocation not on record | 22 |
| Provincia di Livornolocation not on record | 21 |
| Wellington, NZ | 16 |
| Rotorua, NZ | 10 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Canberra, AU | 7 |
| Museo Entomologico de Leonlocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| MeiseBGlocation not on record | 6 |
| Keene State Universitylocation not on record | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 5 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Uppsala, SE | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Mohonk Preservelocation not on record | 4 |
| LfUlocation not on record | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Dresden, DE | 4 |
| Karlsruhe, DE | 4 |
| Palmerston North, NZ | 3 |
| Dekalb, US | 3 |
| Tromso University Museumlocation not on record | 3 |
| PRClocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| *unvoucheredlocation not on record | 3 |
| Wlocation not on record | 3 |
| Porrentruy, CH | 3 |
| GJOlocation not on record | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Québec, CA | 2 |
| Kew, GB | 2 |
| Hobart, AU | 2 |
| IPE-CSIClocation not on record | 1 |
| Denver, US | 1 |
| Pittsburg, US | 1 |
| Fribourg, CH | 1 |
| Brussel, BE | 1 |
| Bruce Peninsula National Parklocation not on record | 1 |
| Jackson, US | 1 |
| Adelaide, AU | 1 |
| GZUlocation not on record | 1 |
| New Brunswick, US | 1 |
| OLAlocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Durham, US | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Davis, US | 1 |
| Chicago, US | 1 |
| Oswego, US | 1 |
| GAlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Norfolk, US | 1 |
| Western Carolina Universitylocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| CIBIOlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
77 institutions · 18 493 of 18 681 vouchered records shown · 184 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA40 detections
Where the DNA of Pilosella officinarum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found40
Studies independent surveys1
Countries10
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 40 detections have coordinates
Open the map10 countries0
In dry, sandy soil of Bromus inermis meadow …On limestone pavement under hydro linein short grassOpen old field
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.5 °C 1.50–18.1
Seasonal swing summer↔winter15.1 °C
Max temp (day)15.5 °C 3.80–23.6
Min temp (night)9.60 °C -1.30–13.5
Precipitation72.2 mm/mo 38.3–123
Air humidity62.1 % 57.2–64.5
Moisture balance-34.0 mm/mo -69.0–118
Vapour deficit586 Pa 263–895
Wind speed3.90 m/s 2.40–6.90
Cloud cover47.8 % 40.9–59.4
CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.