Pilosella aurantiaca
(L.) F.W.Schultz & Sch.Bip. · speciesAt a glance
Occurrence records113 029
Data sources12
Biological traits52
DNA specimens54
eDNA detections25
Sources12 archives
Databases and archives Pilosella aurantiaca's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility113 029 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics54 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources52 traits
Occurrence & distributionGBIF113 029 records
Environmental DNA1 datasets · 6 countries25 detections
DNA & barcodingBOLD · NCBI54 specimens
Genome at a glanceCCDB · GoaT3.9 Gbp
01Narrative
Pilosella aurantiaca (fox-and-cubs, orange hawk bit, devil's paintbrush, grim-the-collier) is a perennial flowering plant in the family Asteraceae that is native to alpine regions of central and southern Europe, where it is protected in several regions.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFT
Size & morphology16
Leaf length max100 mm
Leaf size2 251 mm²
⚠ sources differ — TRY: 2 251 mm² · GIFT: 1 513 mm²
Leaf width20 mm
Leaf width max20 mm
Leaf width min20 mm
Plant height0.188 m
⚠ sources differ — GIFT: 0.188 m · TRY: 0.12 m
Plant height generative0.35 m
Plant height max0.7 m
Plant height min0.15 m
Seed length2 mm
⚠ sources differ — TRY: 2 mm · GIFT: 1.75 mm
Seed length max1.75 mm
Seed length min1.75 mm
Seed mass0.143 mg
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction13
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typewind
Flowering endAug
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 600 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Perennial
Habitat GIFTmeadows
Mycorrhizaabsent
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio24.83 g/g
Leaf c475 mg/g
Leaf dry-matter content (LDMC)160 mg/g
Leaf n14.45 mg/g
Leaf p3.71 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)27.91 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
05DNA & barcoding54 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilosella aurantiaca has left across the world's sequence archives.
At a glance
DNA specimens54
Marker genes9
GenBank sequences10
eDNA detections25
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …
Pilosella aurantiaca voucher SNEW051_BWP 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL1★rbcLa★ITS6★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Pilosella aurantiaca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 853 320 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Pilosella aurantiaca3.85 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records18–722n range36median36mode42records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3630×GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl · CCDB · nw-europe-fl +9
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Moore, D.M. (1982)
CCDB · brit-fl — Watson, P.M. (1969)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3954
CCDB · hieracium — Rosenberg 1917; Sakai 1935; Christoff 1942a; Mulligan 1957; Skalinska 1967; Chouksanova et al. 1968 (as H. a. Boiss.); Taylor & Mulligan 1968; Skalinska 1970; Skalinska et al. 1974; Delcourt 1977; Probatova et al. 1986; Lavrenko et al. 1990
CCDB · hieracium — Finch ined. in D.M. Moore 1982; S. & E. Br?utigam 1996
CCDB · fl-europaea — Skalinska, 1967
CCDB · fl-europaea — Finch, ined.
CCDB · poland — Skali?ska M. 1967. Cytological analysis of some Hieracium species, subg. Pilosella from mountains of southern Poland. Acta Biol. Cracov. Ser. Bot. 10, 127-141.
CCDB · ipcn-api-dl — Krahulcová, A. & F. Krahulec. 1999. Chromosome numbers and reproductive systems in selected representatives of Hieracium subgen. Pilosella in the Krkonoae Mts (the Sudeten Mts). Preslia 71: 217–234.
CCDB · ipcn-api-dl — Schuhwerk, F. & W. Lippert. 2002. Chromosomenzahlen von Hieracium (Compositae, Lactuceae) Teil 4. Sendtnera 8: 167–194.
CCDB · ipcn-api-dl — Krahulcová, A. & F. Krahulec. 2000. Offspring diversity in Hieracium subgen. Pilosella (Asteraceae): new cytotypes from hybridization experiments and from open pollination. Fragm. Florist. Geobot. 45(1–2): 239–255.
CCDB · ipcn-api-dl — Rotreklová, O., A. Krahulcová, D. Vaňková, T. Peckert & P. Mráz. 2002. Chromosome numbers and breeding systems in some species of Hieracium subgen. Pilosella from central Europe. Preslia 74: 27–44.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1990. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 1622–1624.
CCDB · ipcn-api-dl — Schuhwerk, F. & W. Lippert. 1997. Chromosomenzahlen von Hieracium (Compositae, Lactuceae) Teil 1. Sendtnera 4: 181–206.
CCDB · ipcn-api-dl — Finch. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index. Cambridge Univ. Press. Pp. 283–286.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · ipcn-api-dl — Krasnikov. 2004. Chromosome numbers of some species of Hieracium and Pilosella (Asteraceae) from Siberia. Bot. Žhurn. (Moscow & Leningrad) 89(1): 132–133.
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-fedorov — Rosenberg 1917
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Sakai K. 1935a
CCDB · book-fedorov — Christoff 1942
CCDB · book-fedorov — Mulligan 1957
CCDB · book-fedorov — HOBa B ~p. 1968a:
CCDB · kew — Bräutigam S, Bräutigam E. 1996. Determination of the ploidy level in the genus Hieracium subgenus Pilosella (Hill) S.F.Gray by flow cytometric DNA analysis. Folia Geobotanica and Phytotaxonomica 31: 315-321.
CCDB · Cave1957 — Mulligan
CCDB · iapt — IAPT/IOPB Chromosome Data 29
2n 4515×CCDB · slov-fl · CCDB · hieracium · CCDB · fl-europaea +6
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Uhríková A., 1970b: Contribution to the cytology of the taxa Hieracium aurantiacum L. and Hieracium bauhinii Bess. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 61-80.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Skalińska M., Pogan E. et al., 1966: Dalsze badania nad kariologią flory polskiej Cz. VI. - Futher studies in chromosome numbers of Polish Angiosperm. Sixth contribution. - Acta Biol. Cracov., Ser. Bot. 9: 1-58 + fotografické tabule 3-5.
CCDB · slov-fl — Rotreklová O., Krahulcová A., Mráz P., Mrázová V., Mártonfiová L., Peckert T. & Šingliarová B., 2005: Chromosome numbers and breeding systems of some European species of Hieracium subgen. Pilosella. - Preslia 77/2: 177-195.
CCDB · hieracium — Skalinska et al. 1966; Skalinska 1967; Skalinska 1968; M?jovsk?, J. et al. 1970; Skalinska 1970; Uhr?kov? 1970; Delcourt 1977
CCDB · fl-europaea — Skalinska, 1967
CCDB · poland — Skali?ska M. 1967. Cytological analysis of some Hieracium species, subg. Pilosella from mountains of southern Poland. Acta Biol. Cracov. Ser. Bot. 10, 127-141.
CCDB · book-ipcn66 — Skalinska et al. 1966
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — UHRIKOVA, A. 1970. Contribution to the cytology of the taxa Hieracium aurantiacum L. and H. bauhinii Bess. Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 61-67.
CCDB · book-fedorov — Skalinska (SkaliD.ska et al. 1966)
CCDB · kew — Suda J, Krahulcova A, Travnicek P, Rosenbaumova R, Peckert T, Krahulec F. 2007. Genome size variation and species relationships in Hieracium sub-genus Pilosella (Asteraceae) as inferred by flow cytometry. Annals of Botany 100: 1323-1335.
CCDB · iapt — IAPT/IOPB Chromosome Data 29
2n 546×CCDB · hieracium · CCDB · fl-europaea · CCDB · poland +2
CCDB · hieracium — Skalinska 1968; Skalinska et al. 1968; Delcourt 1977
CCDB · fl-europaea — Skalinska et al.
CCDB · poland — Skali?ska M. 1968. Studies in twin plants of Hieracium. Acta Biol. Cracov. Ser. Bot. 11, 179-186.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Schuhwerk, F. & W. Lippert. 2002. Chromosomenzahlen von Hieracium (Compositae, Lactuceae) Teil 4. Sendtnera 8: 167–194.
CCDB · book-ipcn67-71 — SKALINSKA, M., E. POGAN, & A. JANKUN. 1968. Further studies in chromosome numbers of Polish Angiosperms, VII. Acta Biol. Cracov. Ser. Bot. 11: 199-224.
2n 274×CCDB · hieracium · CCDB · fl-europaea · CCDB · poland +1
CCDB · hieracium — Skalinska 1967; Delcourt 1977; Tomb et al. 1978; Mulligan 1984
CCDB · fl-europaea — Skalinska, 1967
CCDB · poland — Skali?ska M. 1967. Cytological analysis of some Hieracium species, subg. Pilosella from mountains of southern Poland. Acta Biol. Cracov. Ser. Bot. 10, 127-141.
CCDB · iapt — IAPT/IOPB Chromosome Data 29
2n 303×CCDB · hieracium · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71
CCDB · hieracium — (??) Zhukova 1964; Zhukova 1967; Pashuk 1987
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
2n 633×CCDB · hieracium · CCDB · fl-europaea · CCDB · poland
CCDB · hieracium — Skalinska 1967
CCDB · fl-europaea — Skalinska, 1967
CCDB · poland — Skali?ska M. 1967. Cytological analysis of some Hieracium species, subg. Pilosella from mountains of southern Poland. Acta Biol. Cracov. Ser. Bot. 10, 127-141.
2n 182×CCDB · hieracium · CCDB · fl-europaea
CCDB · hieracium — Skalinska 1970
CCDB · fl-europaea — Skalinska, 1970
2n 721×CCDB · hieracium
CCDB · hieracium — D.M. Moore 1982
n 182×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Tomb, A. S., K. L. Chambers, D. W. KYHOS, A. M. Powell & P. H. RAVEN. 1978. Chromosome numbers in the Compositae XIV. Lactuceae. Amer. J. Bot. 65: 717–721.
n 91×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — DELCOURT, E. 1977. Contribution à l'etude cytotaxinomique et phytosociologique de Hieracium aurantiacum L. Bull. Soc. bot. Fr. 124: 177–184.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~6.21 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin6.21 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type113 029 records
Wild obs. + sensor111 209
Museum / vouchered1 653
Cultivated / captive14
Other153
Origin
Native64
Introduced5 910
Range
Area of Occupancy AOO177 588 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy62% within 1 km
≤100 m 47 696≤1 km 14 383≤10 km 36 670>10 km 1 582
100 331 georeferenced · 10 878 without coordinates
Open the mapobservation + sensor111 209
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy82% within 1 km
≤100 m 530≤1 km 353≤10 km 146>10 km 53
1 082 georeferenced · 571 without coordinates
Open the institutions mapphysical evidence1 653
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 2
2 georeferenced · 12 without coordinates
Open the mapnot free-living14
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions57 of 111 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 301 |
| Montréal, CA | 117 |
| KMNlocation not on record | 117 |
| Uniwersytet Wrocławskilocation not on record | 116 |
| BRNUlocation not on record | 99 |
| SLU Artdatabankenlocation not on record | 67 |
| Görlitz, DE | 67 |
| Trondheim, NO | 59 |
| Bergen, NO | 47 |
| Christchurch, NZ | 45 |
| TROMlocation not on record | 37 |
| Oskarshamn, SE | 35 |
| BFLlocation not on record | 27 |
| LDlocation not on record | 26 |
| Provincia di Livornolocation not on record | 25 |
| Nagano City, JP | 23 |
| Mlocation not on record | 20 |
| Whitewater, US | 19 |
| DBF-NHMDlocation not on record | 18 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 17 |
| Sion, CH | 17 |
| Tartu, EE | 17 |
| Keene State Universitylocation not on record | 15 |
| Dekalb, US | 12 |
| Otaru, JP | 12 |
| Auckland, NZ | 10 |
| Fukushima Universitylocation not on record | 9 |
| Kushiro City Museumlocation not on record | 9 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 9 |
| Oulu, FI | 9 |
| Wlocation not on record | 8 |
| Kuopio, FI | 7 |
| Philadelphia, US | 7 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 7 |
| KIRMlocation not on record | 7 |
| sonstHerblocation not on record | 7 |
| Québec, CA | 6 |
| nbflocation not on record | 6 |
| Shinshu Universitylocation not on record | 6 |
| Stockholm, SE | 6 |
| Toronto, CA | 6 |
| Helsinki, FI | 5 |
| Chongqing Museumlocation not on record | 5 |
| Toyama, JP | 5 |
| PRClocation not on record | 5 |
| Garðabær, IS | 4 |
| 4 | |
| Moscow State Universitylocation not on record | 4 |
| Tilburg, NL | 3 |
| Beijing, CN | 3 |
| Turku, FI | 3 |
| Sendai, JP | 3 |
| Berlin, DE | 3 |
| PrivatHerblocation not on record | 3 |
| Parkville, AU | 3 |
| Pittsburg, US | 3 |
| Canberra, AU | 3 |
| Frankfurt am Main | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Rotorua, NZ | 2 |
| Sapporo, JP | 2 |
| Porvoo, FI | 2 |
| València, ES | 2 |
| BSBIlocation not on record | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Uppsala, SE | 2 |
| Wellington, NZ | 2 |
| Whitehorse, CA | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| New Brunswick, US | 2 |
| TUR-Alocation not on record | 2 |
| JP | 2 |
| Kew, GB | 2 |
| Madison, US | 2 |
| LfUlocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Dresden, DE | 2 |
| H-Adlerlocation not on record | 1 |
| South Kensington, GB | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Vancouver, CA | 1 |
| QVMAGlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Ypsilanti, US | 1 |
| Durham, US | 1 |
| University of Stellenboschlocation not on record | 1 |
| SIHUlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| WTUlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Université Lavallocation not on record | 1 |
| Denver, US | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Tomioka, JP | 1 |
| Sagamihara, JP | 1 |
| H-Gottschllocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Armidale, AU | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Paris, FR | 1 |
| Karlsruhe, DE | 1 |
| Taipei, TW | 1 |
| Palmerston North, NZ | 1 |
111 institutions · 1 607 of 1 653 vouchered records shown · 46 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA25 detections
Where the DNA of Pilosella aurantiaca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map6 countries0
Edge of lake under Picea sp., Pinus contorta…on grassy road verge
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 5.30–19.1
Seasonal swing summer↔winter27.5 °C
Max temp (day)18.1 °C 10.4–23.6
Min temp (night)10.6 °C 1.40–15.1
Precipitation80.5 mm/mo 67.7–119
Air humidity60.4 % 56.8–66.3
Moisture balance-38.1 mm/mo -68.9–69.2
Vapour deficit644 Pa 446–911
Wind speed3.10 m/s 2.00–4.40
Cloud cover42.0 % 36.0–53.3
CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.