Pilophorus acicularis

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Cladoniaceae/Pilophorus

At a glance

Occurrence records2 595

Data sources8

Biological traits1

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Pilophorus acicularis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 595 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 595 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pilophorus acicularis, commonly known as the nail lichen or the devil's matchstick lichen, is a species of matchstick lichen in the family Cladoniaceae. P. aciculare has both crustose (crust-like) and fruticose thallus (shrub-like) body parts. The lichen starts out as a granular crust on the rock surface, and develops fruticose stalks, or pseudopodetia, up to 3 cm tall and about 1 mm thick that have rounded black apothecia at the tips. The stalks are erect and curved so as to appear combed. It grows directly on silicate rocks in dense clusters. It is found on the west coast of North America up to Alaska, and in eastern Eurasia. In addition to green algae, the lichen contains cyanobacteria that help contribute to soil fertility by supplying fixed nitrogen. It was originally described in 1803, and transferred to the genus Pilophorus in 1857.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilophorus acicularis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ843208.1 ↗531 bpCanada

ACGT

CCCGCGCAGCCCCCCGTTGTCTCTTCACCCTTTGTGTACCTTACCACCGTTGCTTTGGCGGGCCTTATCCGGGCTTCTCGGATGATACCG …

Pilophorus acicularis voucher CCDB-33187-D02 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type2 595 records

Wild obs. + sensor2 104

Museum / vouchered488

Other3

Range

Area of Occupancy AOO5 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 137≤1 km 203≤10 km 114>10 km 170

1 624 georeferenced · 480 without coordinates

Open the mapobservation + sensor2 104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 20≤1 km 148≤10 km 97>10 km 25

290 georeferenced · 198 without coordinates

Open the institutions mapphysical evidence488

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions31 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	105
Madison, US	86
WTUlocation not on record	49
Chicago, US	39
Edmonton, CA	21
LDlocation not on record	17
ASUlocation not on record	17
Durham, US	15
St. Paul, US	13
Boise, US	11
Victoria, CA	11
DOI/NPS, Colonial National Historical Parklocation not on record	11
Bronx, US	10
Uppsala, SE	8
Olocation not on record	7
ILLSlocation not on record	7
Portland, US	6
University of Stellenboschlocation not on record	5
MAlocation not on record	4
New Haven, US	4
Bergen, NO	3
Davis, US	3
Helsinki, FI	3
Berlin, DE	2
Albuquerque, US	2
Nagatoro-machi, Chichibu-gun, JP	2
Minia, EG	2
Stockholm, SE	2
Wuzhou, CN	2
Champaign, US	2
Trondheim, NO	1
Toronto, CA	1
Université Lavallocation not on record	1
Orem, US	1
Pullman, US	1
Ann Arbor, US	1
PHlocation not on record	1
McWane Science Centerlocation not on record	1
Logan, US	1
New Brunswick, US	1
University of British Columbia, Herbariumlocation not on record	1
Madrid, ES	1
US	1

43 institutions · 482 of 488 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Pilophorus acicularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

mouth of river canyon

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 12.8–12.8

Seasonal swing summer↔winter11.6 °C

Max temp (day)16.4 °C

Min temp (night)9.50 °C

Precipitation146 mm/mo

Air humidity63.0 %

Moisture balance25.3 mm/mo

Vapour deficit545 Pa

Wind speed4.40 m/s

Cloud cover38.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources8 archives

Habitat & environment1

At a glance

Record type2 595 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions31 of 43 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 595 records