Pilidiostigma tropicum

L.S.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Pilidiostigma

At a glance

Occurrence records308

Data sources8

Biological traits37

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Pilidiostigma tropicum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility308 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources37 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF308 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pilidiostigma tropicum là một loài thực vật có hoa trong Họ Đào kim nương. Loài này được L.S.Sm. miêu tả khoa học đầu tiên năm 1956.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology15

Fruit length17 mm

Fruit width11 mm

Leaf length65 mm

Leaf mass93.74 mg

Leaf mass per area52.13 g/m2

Leaf size1 517 mm²

Leaf width29 mm

Plant height20 m

Plant height max6 m

Plant height min1 m

Seed length5 mm

Seed mass144 mg

⚠ sources differ — TRY: 144 mg · AusTraits: 88 mg · GIFT: 144 mg

Seed mass max144 mg

Seed mass min144 mg

Seed width2.5 mm

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeanimal

Flowering timennnnnnnnyyyy

Life formshrub or tree

Life spanperennial

Pollination syndromebeetle

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

Leaf compoundnesssimple

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density632 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Pilidiostigma tropicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Ursane and Taraxastane triterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
3-(P-Coumaroyl)Ursolic Acid		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilidiostigma tropicum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences2

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ225449.1 ↗614 bp

ACGT

GAATCCTGCCTAGCAGAATGACCAGAGAACTCGTAACAAACTCAATGGGGGCGTTGGGATTCTTCCCATCAACCCTTGACGTCGTATCGC …

Pilidiostigma tropicum voucher N. Snow 7760 (BISH) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type308 records

Wild obs. + sensor11

Museum / vouchered244

Cultivated / captive2

Other51

Origin

Native6

Range

Area of Occupancy AOO576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 7≤1 km 1≤10 km 1

9 georeferenced · 2 without coordinates

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 23≤1 km 32≤10 km 78>10 km 20

153 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence244

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	95
Brisbane, AU	59
Museo Entomologico de Leonlocation not on record	19
Canberra, AU	15
Honolulu, US	11
Palmerston, AU	7
Mount Annan, AU	6
Kew, GB	5
BISHlocation not on record	4
Adelaide, AU	2
Hobart, AU	1
James Cook Townsvillelocation not on record	1
ASUlocation not on record	1
University of the Sunshine Coastlocation not on record	1
Armidale, AU	1

15 institutions · 228 of 244 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Pilidiostigma tropicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter8.30 °C

Max temp (day)19.8 °C

Min temp (night)11.2 °C

Precipitation36.9 mm/mo

Air humidity60.1 %

Moisture balance-69.4 mm/mo

Vapour deficit690 Pa

Wind speed3.40 m/s

Cloud cover29.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)