Pilidiostigma sessile

N.Snow · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Pilidiostigma

At a glance

Occurrence records74

Data sources6

Biological traits17

DNA specimens3

eDNA detections2

Sources6 archives

Databases and archives Pilidiostigma sessile's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pilidiostigma sessile là một loài thực vật có hoa trong Họ Đào kim nương. Loài này được N.Snow mô tả khoa học đầu tiên năm 2004.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFT

Size & morphology7

Fruit length18 mm

Fruit width8 mm

Leaf length90 mm

Leaf width34 mm

Plant height4 m

Seed length9.5 mm

Seed width4.5 mm

Life cycle & reproduction4

Flowering timeyynnnnnnnnnn

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment6

Climatewet tropical

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: shrub

Leaf compoundnesssimple

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilidiostigma sessile has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496525.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAACTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGCA …

Pilidiostigma sessile isolate BATT251-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa

plant barcode

08Occurrence & distribution

Record type74 records

Wild obs. + sensor2

Museum / vouchered69

Other3

Origin

Native16

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 18≤1 km 12≤10 km 15>10 km 3

48 georeferenced · 21 without coordinates

Open the institutions mapphysical evidence69

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	16
Brisbane, AU	15
Smithfield, AU	14
Honolulu, US	5
Canberra, AU	5
Museo Entomologico de Leonlocation not on record	2
Palmerston, AU	2
Paris, FR	1
Kew, GB	1
Saint Louis, US	1
University of Stellenboschlocation not on record	1
Australian Tropical Herbariumlocation not on record	1
BISHlocation not on record	1

13 institutions · 65 of 69 vouchered records shown · 3 without an institution code

09Environmental DNA2 detections

Where the DNA of Pilidiostigma sessile was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.3 °C 22.0–22.7

Seasonal swing summer↔winter12.5 °C

Max temp (day)26.8 °C 25.5–28.1

Min temp (night)17.5 °C 15.5–19.5

Precipitation228 mm/mo 58.1–399

Air humidity58.2 % 46.4–70.0

Moisture balance53.2 mm/mo -103–210

Vapour deficit1,186 Pa 835–1,536

Wind speed2.90 m/s 2.00–3.80

Cloud cover38.9 % 22.3–55.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)