Pilidiostigma glabrum

Burret · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Myrtales/Myrtaceae/Pilidiostigma

At a glance

Occurrence records1 049

Data sources9

Biological traits35

DNA specimens4

eDNA detections2

Sources9 archives

Databases and archives Pilidiostigma glabrum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 049 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF1 049 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Pilidiostigma glabrum, the plum myrtle, is a small tree or shrub native to the rainforests of eastern Australia. Commonly seen in disturbed sites from near Port Macquarie in the south to Fraser Island in the north. Leaves and floral parts are hairless. Leaves opposite on the stem, 2 to 10 cm long, 1 to 3 cm wide, oil glands, very small. A narrow leaf form is found near Crystal Creek, in northern New South Wales. Small branches coloured purple/brown. White or pink flowers grow relatively large, 2 cm across, appearing from April to November. Fruit are a purplish black pear shaped berry, up to 13 mm in diameter, with four to eight kidney shaped seeds. Seeds germinate easily from 7 to 28 days. Cuttings are slow to strike roots.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology15

Fruit length14 mm

Fruit width13 mm

Leaf length60 mm

Leaf length max100 mm

Leaf length min20 mm

Leaf mass per area54.96 g/m2

Leaf size638 mm²

⚠ sources differ — TRY: 638 mm² · AusTraits: 701 mm²

Leaf width22.5 mm

Leaf width max35 mm

Leaf width min10 mm

Petiole length0.4 cm

Plant height5 m

Plant height max5 m

Seed length5 mm

Seed width3.5 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeyyyynnnnnnyy

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typeberry

Growth formtree

⚠ sources differ — GIFT: tree · AusTraits: tree · TRY: Shrub

Leaf compoundnesssimple

Leaf shapeelliptical oblong ovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)20.78 mm²/mg

03Chemical composition8 compounds

Compounds documented for Pilidiostigma glabrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Dimeric phloroglucinols3

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-2-methyl-1-[1,3,7,9-tetrahydroxy-2,8-dimethyl-6-(2-methylpropanoyl)dibenzofuran-4-yl]butan-1-one	present	LOTUS
(2S)-2-methyl-1-[1,3,7,9-tetrahydroxy-2,8-dimethyl-6-[(2S)-2-methylbutanoyl]dibenzofuran-4-yl]butan-1-one	present	LOTUS
(2S)-2-methyl-1-[1,3,7,9-tetrahydroxy-4,6-dimethyl-8-(2-methylpropanoyl)dibenzofuran-2-yl]butan-1-one	present	LOTUS
2-Methyl-1-[1,3,7,9-tetrahydroxy-2,8-dimethyl-6-(2-methylbutanoyl)dibenzofuran-4-yl]butan-1-one	present	LOTUS
2-Methyl-1-[1,3,7,9-tetrahydroxy-2,8-dimethyl-6-(2-methylpropanoyl)dibenzofuran-4-yl]propan-1-one	present	LOTUS
2-Methyl-1-[1,3,7,9-tetrahydroxy-4,6-dimethyl-8-(2-methylpropanoyl)dibenzofuran-2-yl]propan-1-one	present	LOTUS
Rhodomyrtoxin C	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pilidiostigma glabrum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ225448.1 ↗611 bp

ACGT

GAATCCTGCCCAGCAGAATGACCAGAGAACTCGTAACGAACTCAATGGAGGCGTTGGGATTCTTCCCATCGTCCCTTGACGTCGTATCGC …

Pilidiostigma glabrum voucher N. Snow 7762 (BISH) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 049 records

Wild obs. + sensor811

Museum / vouchered201

Cultivated / captive4

Other33

Origin

Native48

Range

Area of Occupancy AOO2 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 643≤1 km 66≤10 km 12>10 km 37

758 georeferenced · 53 without coordinates

Open the mapobservation + sensor811

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 29≤1 km 20≤10 km 77>10 km 43

169 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence201

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤100 m 2>10 km 1

3 georeferenced · 1 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	59
Mount Annan, AU	48
Museo Entomologico de Leonlocation not on record	43
Canberra, AU	18
Armidale, AU	13
Honolulu, US	4
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Smithfield, AU	3
BISHlocation not on record	2
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	1
Hobart, AU	1
Kew, GB	1
Palmerston, AU	1
La Trobe Universitylocation not on record	1

14 institutions · 198 of 201 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pilidiostigma glabrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.4 °C 16.4–16.4

Seasonal swing summer↔winter11.0 °C

Max temp (day)21.6 °C

Min temp (night)12.0 °C

Precipitation130 mm/mo

Air humidity61.8 %

Moisture balance16.5 mm/mo

Vapour deficit718 Pa

Wind speed3.00 m/s

Cloud cover24.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pilidiostigma glabrum

At a glance

Sources9 archives

Size & morphology15

Life cycle & reproduction7

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Compound class profile1 class

Documented compounds8 total

At a glance

Record type1 049 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 049 records