Picea jezoensis

(Siebold & Zucc.) Carrière · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Pinaceae/Picea

At a glance

Occurrence records1 100

Data sources12

Biological traits27

DNA specimens22

eDNA detections23

Sources12 archives

Databases and archives Picea jezoensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources27 traits

Chemical compositionLOTUS · NPASS290 compounds

Occurrence & distributionGBIF1 100 records

Environmental DNA1 datasets · 4 countries23 detections

DNA & barcodingBOLD · NCBI22 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Picea jezoensis, en français Épicéa du Japon, est un conifère d'Asie appartenant au genre Picea (épicéa). Son nom vient de l'île d'Ezo, ancien nom de Hokkaidō, l'île la plus septentrionale du Japon, où les premiers spécimens ont été décrits par les naturalistes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology6

Leaf size736 mm²

Plant height35.21 m

Plant height max50 m

Seed mass2.47 mg

⚠ sources differ — TRY: 2.47 mg · GIFT: 4.28 mg

Seed mass max6.02 mg

Seed mass min2.17 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life formtree

Life spanperennial

Lifespan years290 years

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTforest

Mycorrhiza typeectomycorrhizal

Woodinesswoody

Physiology & chemistry7

Leaf c480 mg/g

Leaf dry-matter content (LDMC)396 mg/g

Leaf n10.87 mg/g

Leaf p2.21 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)2.44 mm²/mg

Wood density398 mg/cm³

⚠ sources differ — TRY: 398 mg/cm³ · GIFT: 459 mg/cm³

03Chemical composition290 compounds

Compounds documented for Picea jezoensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Serratane triterpenoids31

Taxane diterpenoids14

Monomeric stilbenes10

Oligomeric stibenes7

Isocoumarins6

Documented compounds290 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-lariciresinol	present	NPASS
(+)-Pinoresinol	present	NPASS
(+)-taxifolin	present	LOTUS
(-)-Sandaracopimaric acid	present	NPASS
(1R,3S,4R,7S,9R,12S,14S,17S,19R,22S)-14,19-dihydroxy-7-methoxy-4,8,8,12,18,18,22-heptamethylpentacyclo[12.9.0.03,12.04,9.017,22]tricosan-23-one	present	LOTUS
(1R,3S,4R,9R,12S,14S,17S,19S,22S)-14-hydroxy-19-methoxy-4,8,8,12,18,18,22-heptamethylpentacyclo[12.9.0.03,12.04,9.017,22]tricosane-7,23-dione	present	LOTUS
(1R,3S,6S,11R,12R,15R,16S,19S,21S)-19-methoxy-3,7,7,11,16,20,20-heptamethyl-24-oxahexacyclo[13.8.1.01,15.03,12.06,11.016,21]tetracosan-8-one	present	LOTUS
(1R,3S,6S,8S,11R,12S,15R,16S,19R,21S)-8-methoxy-3,7,7,11,16,20,20-heptamethyl-24-oxahexacyclo[13.8.1.01,15.03,12.06,11.016,21]tetracosan-19-ol	present	LOTUS
(1R,4abeta)-Decahydro-1beta-[(E)-5-hydroxy-3-methyl-3-pentenyl]-2,5,5,8abeta-tetramethylnaphthalen-2alpha-ol	present	LOTUS
(1R,4aS,10aR)-6-hydroxy-1,4a-dimethyl-7-propan-2-yl-2,3,4,9,10,10a-hexahydrophenanthrene-1-carboxylic acid	present	NPASS

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Picea jezoensis has left across the world's sequence archives.

At a glance

DNA specimens22

Marker genes3

GenBank sequences10

eDNA detections23

Countries4

The DNA barcodea real sequence read deposited for this species

rbcLLC694053.1 ↗599 bpJapan · 2011

ACGT

TAGTGTCGGATTTAAAGCTGGTGTTAAAGATTACAGATTAACTTATTATACTCCTGAATATCAGACCAAAGATACGGATATTTTGGCAGC …

Picea jezoensis subsp. hondoensis TF<JPN>:SMG_10 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Picea jezoensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode12records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2412×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.

CCDB · ipcn-api-dl — Muratova, E. N., O. S. Vladimirova & T. S. Sedelnikova. 2001. Chromosome numbers of some gymnosperms. Bot. Žhurn. (Moscow & Leningrad) 86(8): 143–144.

CCDB · ipcn-api-dl — Karpyuk. 2005. Karyosystematic analysis of Picea jezoensis (Siebold et Zucc.) Carr. Pages 46--47 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.

CCDB · ipcn-api-dl — Hizume, M. 1988. Karyomorphological studies in the family Pinaceae. Mem. Fac. Educ. Ehime Univ., Ser. 3, Nat. Sci. 8: 1–108.

CCDB · ipcn-api-dl — Nkongolo, K. K. 1999. RAPD and cytological analyses of Picea spp. from different provenances: genomic relationships among taxa. Hereditas (Lund) 130: 137–144.

CCDB · ipcn-api-dl — Muratova, E. N., A. V. Pimenov, T. S. Sedelnikova & M. I. Nelyubina. 1998. Chromosome numbers of some woody plants. Bot. Žhurn. (Moscow & Leningrad) 83(2): 148–149.

CCDB · ipcn-api-dl — Muratova. 2005. Caryological and cytogenetic studies of coniferous plants of Siberia and Far East. Sibirskii Ëkol. Žur. 12(5): 573–582.

CCDB · ipcn-api-dl — Muratova. 2000. Karyotipic variability and anomalies in populations of conifers from Siberia and the Far East. Pages 129--141 in H. Guttenberger, Ž. Borzan, S. E. Schlarbaum & T. P. V. Hartman (eds), Cytogenetic Studies of Forest Trees and Shrubs---Review, Present Status, and Outlook on the Future. Arbora Publishers, Zloven, Slovakia.

CCDB · ipcn-api-dl — Du, F. g., B. h. Wu, Z. l. Sun & S. Zhang. 1996. A karyotype analysis of Picea jezoensis var. microsperma. Acta Agric. Univ. Henan. 30(2): 172–174.

CCDB · ipcn-api-dl — Hizume, M. & Y. Kuzukawa. 1995. Fluorescent chromosome banding in Picea II. Relationships between rDNA loci and chromomycin A3-bands in somatic chromosomes of P. jezoensis var. hondoensis. Kromosomo 79–80: 2754–2759.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 100 records

Wild obs. + sensor905

Museum / vouchered174

Cultivated / captive18

Other3

Range

Area of Occupancy AOO2 480 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy56% within 1 km

≤100 m 237≤1 km 70≤10 km 131>10 km 115

553 georeferenced · 352 without coordinates

Open the mapobservation + sensor905

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤1 km 10≤10 km 12>10 km 1

23 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence174

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 17 without coordinates

Open the mapnot free-living18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	24
Servico de Microbiologia e Imunologialocation not on record	16
Cambridge, US	13
Kyoto Universitylocation not on record	8
Guangzhou, CN	8
Herbarium of the Department of Botany, University of Tokyolocation not on record	7
WTUlocation not on record	7
Otaru, JP	6
FFPRIlocation not on record	6
Chiba, JP	6
LDlocation not on record	5
KR	4
Paris, FR	4
Beijing, CN	3
Rotorua, NZ	3
MeiseBGlocation not on record	3
Kushiro City Museumlocation not on record	2
Sichuan Grassland Research Institutelocation not on record	2
Philadelphia, US	2
Canadian Department of Agriculturelocation not on record	2
Vancouver, CA	1
Xining, CN	1
Saint Louis, US	1
Museum of the Rockieslocation not on record	1
University of Silesia in Katowicelocation not on record	1
Toyama, JP	1
Guilin, CN	1
Bronx, US	1
Uniwersytet Jagiellońskilocation not on record	1
Forestry and Forest Products Research Institutelocation not on record	1
Philadelphia, US	1
Auckland, NZ	1
Bando, JP	1
Odawara, JP	1
WNNUlocation not on record	1
Nagano City, JP	1
Honolulu, US	1

37 institutions · 148 of 174 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA23 detections

Where the DNA of Picea jezoensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 7.40–25.2

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.1 °C 9.60–28.5

Min temp (night)11.4 °C 3.00–21.0

Precipitation296 mm/mo 39.0–344

Air humidity64.9 % 50.6–65.7

Moisture balance155 mm/mo -119–263

Vapour deficit617 Pa 428–1,358

Wind speed2.80 m/s 2.30–4.50

Cloud cover44.2 % 28.8–45.4

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Picea jezoensis

At a glance

Sources12 archives

Size & morphology6

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry7

Compound class profile5 classes

Documented compounds290 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 100 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 37 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 100 records