Picea abies
(L.) H.Karst. · speciesAt a glance
Occurrence records889 388
Data sources13
Biological traits130
DNA specimens64
eDNA detections43
Sources13 archives
Databases and archives Picea abies's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility889 388 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics64 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources130 traits
Chemical compositionLOTUS · NPASS331 compounds
Occurrence & distributionGBIF889 388 records
Environmental DNA1 datasets · 8 countries43 detections
DNA & barcodingBOLD · NCBI64 specimens
Genome at a glanceCCDB · GoaT · NCBI18.4 Gbp
01Narrative
L’Épicéa commun est une espèce d’arbres résineux de la famille des Pinacées et du genre Picea originaire d'Europe. Adapté aux climats froids et humides, l'Épicéa commun est naturellement présent en plaine dans les forêts boréales d'Europe septentrionale, dont il est une essence majeure, tandis qu'il n'est généralement présent de façon spontanée en Europe moyenne et méridionale qu'en montagne au-dessus de 400 m. Mais il a aussi été beaucoup planté hors de son aire, y compris à basse altitude en Europe moyenne, ainsi que dans le sud-est du Canada. Il présente des cônes à port retombant, ce qui permet de le distinguer du Sapin pectiné.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology13
Fruit length130 mm
Leaf length15 mm
Leaf length max20 mm
Leaf length min10 mm
Leaf size93.37 mm²
Plant height45 m
⚠ sources differ — GIFT: 45 m · AusTraits: 30 m · LEDA: 50 m · USDA: 39.62 m · TRY: 6.21 m
Plant height generative20 m
Plant height max50 m
Plant height min10 m
Seed length4.62 mm
Seed mass6.78 mg
⚠ sources differ — TRY: 6.78 mg · LEDA: 7.15 mg · GIFT: 17.49 mg
Seed mass max60.5 mg
Seed mass min5.9 mg
Life cycle & reproduction35
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flowering endJun
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDASlow
Life formtree
Life spanperennial
Lifespan categoryModerate
Lifespan years400 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityYes
Seed number80 374
Seed spread rateSlow
Seedling vigorMedium
Self fertilizationabsent
Sex typemonoecious
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment27
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureMedium
Fruit colourbrown
Fruit typestrobilus
Growth formtree
Growth form USDASingle Stem
Habitat GIFTforming forests; loamy, damp soils, shade-resistant
Hedge toleranceHigh
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Mycorrhiza typeectomycorrhizal
Root depth min28 in
Shape and orientationClimbing
Small grainNo
Woodinesswoody
Physiology & chemistry30
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min100 days
Leaf C:N ratio38.8 g/g
Leaf c496 mg/g
Leaf dry-matter content (LDMC)452 mg/g
Leaf n12.64 mg/g
Leaf p1.45 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min24 in
Salinity toleranceLow
Seed longevity index0
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5 pH
Specific leaf area (SLA)3.9 mm²/mg
⚠ sources differ — TRY: 3.9 mm²/mg · LEDA: 3.79 mm²/mg · GIFT: 6.85 mm²/mg
Temperature min-38 °F
Wood density470 mg/cm³
Wood density max370 mg/cm³
Wood density min370 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productYes
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound64 000 per lb
ToxicityNone
Veneer productNo
Other traits8
Diaspore typeseed
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr10.67 m
Planting density max700 per acre
Planting density min300 per acre
03Chemical composition331 compounds
Compounds documented for Picea abies across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols28
Cinnamic acids and derivatives21
Pinane monoterpenoids14
Monomeric stilbenes14
Simple phenolic acids11
Documented compounds331 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-3-Carene | present | LOTUS | |
| (+)-alpha-Bulgarene | present | LOTUS | |
| (+)-alpha-Pinene | present | LOTUS | |
| (+)-beta-Caryophyllene | present | LOTUS | |
| (+)-beta-Fenchene | present | LOTUS | |
| (+)-beta-Phellandrene | present | LOTUS | |
| (+)-Camphene | present | LOTUS | |
| (+)-Fenchone | present | LOTUS | |
| (+)-gamma-Bulgarene | present | LOTUS |
05DNA & barcoding64 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Picea abies has left across the world's sequence archives.
At a glance
DNA specimens64
Marker genes8
GenBank sequences10
eDNA detections43
Countries8
The DNA barcodea real sequence read deposited for this species
ATGTATTTGGATTCAAGGCCCTACGGGCTCTACGTTTGGAAGATTTGCGGATTCCCCCTGCTTATTCCAAAACATTTCAAGGTCCACCTC …
Picea abies voucher HK67 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK5★rbcL5★rbcLa★trnL-F★ITS1★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Picea abies carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size18 430 410 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Picea abies18.43 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–242n range24median24mode45records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2445×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1551
CCDB · mediterranean
CCDB · ipcn-api-dl — Hizume, M. 1988. Karyomorphological studies in the family Pinaceae. Mem. Fac. Educ. Ehime Univ., Ser. 3, Nat. Sci. 8: 1–108.
CCDB · ipcn-api-dl — Müller, M., H. Guttenberger, D. Grill, B. Drǔskovĭc & J. Paradĭz. 1991. A cytogenetic method for examining the vitality of spruces. Phyton (Horn) 31: 143–155.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Fuchs, J., A. Brandes & I. Schubert. 1995. Telomere sequence localization and karyotype evolution in higher plants. Pl. Syst. Evol. 196: 227–241.
CCDB · ipcn-api-dl — Guttenberger, H. & M. Müller. 1996. Quantitative karyotyping of Norway spruce root meristems by image analysis methods and pattern recognition. Phyton (Horn) 36: 127–133.
CCDB · ipcn-api-dl — Nkongolo, K. K. 1999. RAPD and cytological analyses of Picea spp. from different provenances: genomic relationships among taxa. Hereditas (Lund) 130: 137–144.
CCDB · ipcn-api-dl — Muratova, E. N., O. S. Vladimirova & T. S. Sedelnikova. 2001. Chromosome numbers of some gymnosperms. Bot. Žhurn. (Moscow & Leningrad) 86(8): 143–144.
CCDB · ipcn-api-dl — Überall, I., J. Vrána, J. Bartoa, J. `merda, J. Doležel & L. Havel. 2004. Isolation of chromosomes from Picea abies and their analysis by flow cytometry. Biol. Pl. 48(2): 199–203.
CCDB · ipcn-api-dl — Petrova, A. 2006. Mediterranean chromosome number reports 16 (1584--1603). Fl. Medit. 16: 431–442.
CCDB · ipcn-api-dl — Ivanova. 2005. Mediterranean chromosome number reports 15 (1445--1456). Fl. Medit. 15: 719–728.
CCDB · ipcn-api-dl — Muratova. 2005. Caryological and cytogenetic studies of coniferous plants of Siberia and Far East. Sibirskii Ëkol. Žur. 12(5): 573–582.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · book-ipcn72 — TERASMAA, T. 1972. A comparative karyomorphological study of Estonian and Lapland provenances of Picea abies (L.l Karst. Ann. Bot. Fenn. 9: 97-101.
CCDB · book-ipcn67-71 — TOYAMA, s., & Y. KUROKI. 1967. Karyotype studies in forest trees. 3. Chromosomes of some Pinaceae. Seiken Ziho 19: 61-62.
CCDB · book-ipcn75-78 — Vachova 1974a
CCDB · book-ipcn75-78 — Terasmaa 1975
CCDB · book-northern-plants — Andersson 1947.
CCDB · book-ipcn73-74 — TERASMAA, T. 1971. Karyotype analysis of Norway Spruce Picea abies (L. l Karst. Silvae Genet. 20: 179-182.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · eflora
CCDB · book-atlas-flowering-plants — Sax & S. 1933
CCDB · CromoCat 2015 — Muratova (2005). Cytogenetic and karyological study of mountain and valley populations of conifers in view of their adaptations to environment. Pages 230–235 in Relief and Industrial Enterprises of Mountain and Valley Territories. Barnaul: Altai State Uni
CCDB · CromoCat 2015 — Petrova, A., Zieli?ski, J. & Natcheva, R. (2006). Reports (1584-1603). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-16 Fl. Medit. 16: 431-442
CCDB · CromoCat 2015 — Sedelnikova
Sedelnikova (2005). Chromosome numbers of some coniferous species Bot. Žhurn. (Moscow & Leningrad) 90(10): 1611–1612.
CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Fuchs, J., Brandes, A. & Schubert, I. (1995). Telomere sequence localization and karyotype evolution in higher plants. Pl. Syst. Evol. 196: 227-241.
CCDB · CromoCat 2015 — Guttenberger, H. & Müller, M. (1996). Quantitative karyotyping of Norway spruce root meristems by image analysis methods and pattern recognition Phyton. Annales Rei Botanicae 36: 127-133
CCDB · CromoCat 2015 — Hizume, M. (1988). Karyomorphological studies in the family Pinaceae. Mem. Ehime Univ. Sci. 8: 1-108.
CCDB · CromoCat 2015 — Ivanova, D., Vladimirov, V. & Stanimirova, P. (2005). Reports (1445-1456). In: Kamari, Blanché & Garbari (eds): Mediterranean chromosome number reports-15 Fl. Medit. 15: 719-728
CCDB · CromoCat 2015 — Müller, M., H. Guttenberger, D. Grill, B. Druskovic & J. Paradiz (1991). A cytogenetic method for examining the vitality of spruces Phyton. Annales Rei Botanicae 31: 143-155
CCDB · CromoCat 2015 — Nkongolo, K. K. (1999). RAPD and cytological analyses of Picea spp. from different provenances: genomic relationships among taxa Hereditas; genetiskt arkiv. 130: 137-144
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type889 388 records
Wild obs. + sensor844 431
Museum / vouchered33 871
Cultivated / captive3 768
Fossil42
Other7 276
Origin
Native165
Introduced21 162
Range
Area of Occupancy AOO690 964 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 212 588≤1 km 227 836≤10 km 253 698>10 km 2 947
697 069 georeferenced · 147 362 without coordinates
Open the mapobservation + sensor844 431
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy29% within 1 km
≤100 m 2 337≤1 km 5 903≤10 km 20 123>10 km 407
28 770 georeferenced · 5 101 without coordinates
Open the institutions mapphysical evidence33 871
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy19% within 1 km
≤100 m 10≤1 km 5≤10 km 53>10 km 11
79 georeferenced · 3 689 without coordinates
Open the mapnot free-living3 768
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions128 of 211 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 26 358 |
| Karlsruhe, DE | 1 078 |
| BFLlocation not on record | 639 |
| Salzburg, AT | 613 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 401 |
| LDlocation not on record | 384 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 357 |
| Helsinki, FI | 324 |
| Görlitz, DE | 184 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 181 |
| SLU Artdatabankenlocation not on record | 143 |
| Millersville, US | 95 |
| Moscow State Universitylocation not on record | 89 |
| Mlocation not on record | 84 |
| Olocation not on record | 84 |
| BIO-UNIPIlocation not on record | 66 |
| DBF-NHMDlocation not on record | 65 |
| Trondheim, NO | 49 |
| University of Silesia in Katowicelocation not on record | 47 |
| Oskarshamn, SE | 32 |
| Turku, FI | 32 |
| Oulu, FI | 32 |
| Chongqing Museumlocation not on record | 29 |
| Provincia di Livornolocation not on record | 29 |
| Bronx, US | 28 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 28 |
| TROMlocation not on record | 26 |
| Paris, FR | 24 |
| Zürich, CH | 23 |
| Uniwersytet Opolskilocation not on record | 20 |
| Uppsala, SE | 19 |
| M-Lichenslocation not on record | 16 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 15 |
| Tartu, EE | 14 |
| KMNlocation not on record | 13 |
| Vitoria, ES | 13 |
| Christchurch, NZ | 12 |
| Rotorua, NZ | 11 |
| Denver, US | 11 |
| Berlin, DE | 11 |
| SWE054location not on record | 11 |
| South Kensington, GB | 11 |
| Santiago de Compostela, ES | 10 |
| Beijing, CN | 10 |
| Jyväskylä, FI | 10 |
| MeiseBGlocation not on record | 10 |
| Ann Arbor, US | 10 |
| Toronto, CA | 10 |
| MAlocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Wuzhou, CN | 8 |
| SZUlocation not on record | 8 |
| Bern, CH | 7 |
| Tampere, FI | 7 |
| Auckland, NZ | 7 |
| Tromso University Museumlocation not on record | 7 |
| Armidale, AU | 7 |
| Minia, EG | 7 |
| University of New Hampshirelocation not on record | 6 |
| Philadelphia, US | 6 |
| Otaru, JP | 6 |
| Frankfurt am Main | 6 |
| Kuopio, FI | 6 |
| Museo Entomologico de Leonlocation not on record | 6 |
| Saint Louis, US | 6 |
| PrivatHerblocation not on record | 6 |
| Green Bay, US | 6 |
| Porvoo, FI | 6 |
| Nagano City, JP | 6 |
| College of the Atlantic, Museumlocation not on record | 6 |
| St. Paul, US | 5 |
| Pullman, US | 5 |
| Odawara, JP | 5 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 5 |
| Allentown, US | 5 |
| CICYTEXlocation not on record | 5 |
| Madison, US | 5 |
| Université Lavallocation not on record | 5 |
| Mount Pleasant, US | 5 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Entomological Society of Latvialocation not on record | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Hobart, AU | 4 |
| Saint John, CA | 4 |
| Shanghai, CN | 4 |
| Dresden, DE | 4 |
| Hudson, US | 4 |
| Dekalb, US | 4 |
| nbflocation not on record | 4 |
| Philadelphia, US | 4 |
| Cincinnati, US | 4 |
| Sanda, JP | 3 |
| Columbia, US | 3 |
| Wlocation not on record | 3 |
| TUR-Alocation not on record | 3 |
| Tempe, US | 3 |
| Tampa, US | 3 |
| BRNUlocation not on record | 3 |
| College Park, US | 3 |
| Williamsburg, US | 3 |
| BDBClocation not on record | 3 |
| Tennessee Technological Universitylocation not on record | 3 |
| San Sebastián, ES | 3 |
| Macomb, US | 3 |
| SIHUlocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| IFR-DNFlocation not on record | 3 |
| Canberra, AU | 3 |
| Chicago, US | 3 |
| BClocation not on record | 3 |
| Tokushima, JP | 3 |
| Barcelona, ES | 3 |
| Mount Annan, AU | 2 |
| LfUlocation not on record | 2 |
| Kew, GB | 2 |
| Chicago, US | 2 |
| University of Hamburglocation not on record | 2 |
| Porrentruy, CH | 2 |
| Tallinn, EE | 2 |
| Edinburgh, GB | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| FFPRIlocation not on record | 2 |
| Bando, JP | 2 |
| Bergen, NO | 2 |
| Montréal, CA | 2 |
| New Haven, US | 2 |
| Claremont, US | 2 |
| Rovaniemi, FI | 2 |
| University of Stellenboschlocation not on record | 2 |
| Santa Barbara, US | 2 |
| Lausanne, CH | 2 |
| Universidad Católica de Santa Maríalocation not on record | 2 |
| Staten Island, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| New Brunswick, US | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| Tsukuba, JP | 1 |
| H-Schuhwlocation not on record | 1 |
| Los Angeles, US | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Maringá, BR | 1 |
| US | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| València, ES | 1 |
| Nanjing, CN | 1 |
| Badajoz, ES | 1 |
| Phoenix, US | 1 |
| Zhuzhou, CN | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Waverly, US | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Morgantown, US | 1 |
| Stockholm, SE | 1 |
| McWane Science Centerlocation not on record | 1 |
| Vancouver, CA | 1 |
| Museum of the Rockieslocation not on record | 1 |
| EL PASO, US | 1 |
| Bloomington, US | 1 |
| Göteborg, SE | 1 |
| Boise, US | 1 |
| Flagstaff, US | 1 |
| Madrid, ES | 1 |
| Asheville, US | 1 |
| Albuquerque, US | 1 |
| Durham, US | 1 |
| Tulane Universitylocation not on record | 1 |
| Bothell, US | 1 |
| Hamilton, US | 1 |
| Davis, US | 1 |
| Oswego, US | 1 |
| Zürich, CH | 1 |
| Logan, US | 1 |
| Durban, ZA | 1 |
| WTUlocation not on record | 1 |
| Fredericksburg, US | 1 |
| UEMlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| Granada, ES | 1 |
| Fribourg, CH | 1 |
| Mississippi State, US | 1 |
| Tilburg, NL | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Richmond, US | 1 |
| Norfolk, US | 1 |
| JP | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Bangkok, TH | 1 |
| Keene State Universitylocation not on record | 1 |
| Banyoles, ES | 1 |
| San Jose, US | 1 |
| Toyama, JP | 1 |
| UChlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Clemson, US | 1 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 1 |
| H-Wolflocation not on record | 1 |
| Philadelphia, US | 1 |
| BSBIlocation not on record | 1 |
| Moscow, US | 1 |
| Herb. BBGlocation not on record | 1 |
| Riverside, US | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| GJOlocation not on record | 1 |
211 institutions · 32 184 of 33 871 vouchered records shown · 1 659 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA43 detections
Where the DNA of Picea abies was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map8 countries0
S-facing, birch-maple wood; dry and steep; s…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.6 °C 4.00–14.5
Seasonal swing summer↔winter22.3 °C
Max temp (day)13.5 °C 7.40–18.9
Min temp (night)8.00 °C 1.30–9.30
Precipitation72.2 mm/mo 54.8–111
Air humidity63.2 % 58.3–66.6
Moisture balance5.10 mm/mo -24.8–64.6
Vapour deficit496 Pa 326–782
Wind speed2.60 m/s 2.10–3.50
Cloud cover47.6 % 40.9–68.3
CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.