Phytolacca japonica

Makino · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Phytolaccaceae/Phytolacca

At a glance

Occurrence records663

Data sources10

Biological traits16

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Phytolacca japonica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility663 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources16 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF663 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 72

01Narrative

Phytolacca japonica is a species of flowering plant in the pokeweed family (Phytolaccaceae). It native to eastern Asia, where it is found in China and Japan (from the Kantō region westward).Phytolacca japonica (in Japanese), Flora of Mikawa Its natural habitat is in forests edges, in ravines and along riversides.Phytolacca japonica Flora of China Phytolacca japonica is an herbaceous perennial, growing to 1.5 meters tall. Its stem is thick and fleshy, and turns red with age. It produces erect racemes of flowers that are initially pale pink, turning reddish with maturity. Flowering time is from June to September. Its ripe fruits are purplish-black. It can be distinguished from the similar-looking Phytolacca acinosa by its fused carpels, and from Phytolacca americana by its more dense and erect inflorescence.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology7

Leaf length235 mm

Leaf length max320 mm

Leaf length min150 mm

Leaf width75 mm

Leaf width max100 mm

Leaf width min50 mm

Plant height1 m

Life cycle & reproduction2

Life formperennial

Life spanperennial

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max1 100 m

Elevation mean725 m

Elevation min350 m

Growth formherb

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Phytolacca japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Aminoacids1

Imidazole alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
4-aminobutanoate		present	LOTUS
Histamine		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phytolacca japonica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG595704.1 ↗627 bp

ACGT

GGATCATTGTCGAAACCTGCCCAGCAGAACGACCAGCGAACATGTTATCTCACATCGGGAGGGGAATCCGTTGCCCTTGGGCTTCGGTCA …

Phytolacca japonica voucher xd0003(JIU) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phytolacca japonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 72 n = 36

Ploidypolyploid inferred

Chromosome records72–722n range72median72mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 722×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Oginuma, K. & R. TANAKA. 1980. Karyomorphological studies on three species of Phytolacca of Japan. Chromosome Inform. Serv. 29: 6-8. Chromosome Inf. Serv. 29: 6–8.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type663 records

Wild obs. + sensor370

Museum / vouchered292

Other1

Origin

Native13

Range

Area of Occupancy AOO1 540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 191≤1 km 41≤10 km 30>10 km 10

272 georeferenced · 98 without coordinates

Open the mapobservation + sensor370

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1≤10 km 3

6 georeferenced · 286 without coordinates

Open the institutions mapphysical evidence292

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sanda, JP	80
Taipei, TW	32
National Museum of Natural Sciencelocation not on record	29
Osaka, JP	24
Odawara, JP	21
Kunming, CN	14
Beijing, CN	13
TAIElocation not on record	13
Tokushima, JP	12
Taipei, TW	12
Tsukuba, JP	7
Sagamihara, JP	4
Sendai, JP	3
Shinshu Universitylocation not on record	3
Hangzhou, CN	3
Siouxland Heritage Museumlocation not on record	3
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	3
Nanjing, CN	2
Guangzhou, CN	2
Yangling, CN	2
Nishihara, JP	2
Zhejiang Museum of Natural Historylocation not on record	1
Wuhan, CN	1
KIRMlocation not on record	1
Nagano City, JP	1
Museum Of Natural And Environmental History, Shizuokalocation not on record	1
Chiba, JP	1
Auckland, NZ	1
Fukushima Universitylocation not on record	1

29 institutions · 292 of 292 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Phytolacca japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)