Phytolacca icosandra
speciesAt a glance
Occurrence records5 148
Data sources12
Biological traits54
DNA specimens43
eDNA detections19
Sources12 archives
Databases and archives Phytolacca icosandra's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 148 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics43 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources54 traits
Chemical compositionLOTUS · NPASS22 compounds
Occurrence & distributionGBIF5 148 records
Environmental DNA1 datasets · 3 countries19 detections
DNA & barcodingBOLD · NCBI43 specimens
Genome at a glanceCCDB2n = 36
01Narrative
Le Raisin tropical est une espèce de plantes herbacées, vivaces, de la famille des Phytolaccaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology27
Fruit length7 mm
⚠ sources differ — AusTraits: 7 mm · GIFT: 8 mm
Fruit width5.5 mm
⚠ sources differ — AusTraits: 5.5 mm · GIFT: 8 mm
Leaf length80 mm
Leaf length max160 mm
Leaf length min50 mm
Leaf mass39 mg
Leaf mass per area45.66 g/m2
Leaf size864 mm²
Leaf width27.25 mm
⚠ sources differ — AusTraits: 27.25 mm · GIFT: 40 mm
Leaf width max70 mm
Leaf width min10 mm
Petiole length4 cm
Plant height2.38 m
⚠ sources differ — GIFT: 2.38 m · AusTraits: 2 m · TRY: 1 m
Plant height max2 m
Plant height min0.4 m
Seed length2 mm
⚠ sources differ — AusTraits: 2 mm · GIFT: 2.25 mm
Seed length max2.25 mm
Seed length min2.25 mm
Seed mass5.08 mg
Seed mass max6.27 mg
Seed mass min4.17 mg
Seed volume4.9 mm³
Seed volume max4.9 mm³
Seed volume min4.9 mm³
Seed width2.25 mm
Seed width max2.25 mm
Seed width min2.25 mm
Life cycle & reproduction10
Deciduousnessevergreen
⚠ sources differ — TRY: E · GIFT: variable
Dispersal typeanimal
Flowering timeyynnnnnnnnyy
Life formperennial
Life spanperennial
Raunkiær life formphanerophyte
Reproduction asexualabsent
Reproductive maturity0.558 years
Resprouting capacityresprouts
Sex typedioecious
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max3 300 m
Elevation min4 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formherb
Habitat GIFTdense secondary shrub and ruderal vegetation
Leaf compoundnesssimple
Leaf shapeelliptical lanceolate
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · AusTraits: herbaceous woody_root · GIFT: non-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)21.9 mm²/mg
03Chemical composition22 compounds
Compounds documented for Phytolacca icosandra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Oleanane triterpenoids16
Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids2
Ursane and Taraxastane triterpenoids1
Taraxerane triterpenoids1
Documented compounds22 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,4aR,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4R,5R,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-methoxycarbonyl-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2R,4aR,6aR,6aS,6bR,9R,10S,12aR,14bR)-10-hydroxy-9-(hydroxymethyl)-2-methoxycarbonyl-2,6a,6b,9,12a-pentamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2R,4aR,6aS,6aR,6bS,8aS,10R,12aS,14bS)-10-[(2S,3S,4R,5R,6S)-3-[(2R,3S,4R,5R,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-2,4a-dicarboxylic acid | present | LOTUS | |
| (2R,4aS,6aS,6aS,6bR,8aR,10S,12aR,14bR)-10-[(2S,3S,4R,5S,6S)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-methoxycarbonyl-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2R,4aS,6aS,6aS,6bR,8aR,10S,12aR,14bR)-10-[(2S,3S,4R,5S,6S)-4-[(2R,3S,4R,5S,6S)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2R,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-methoxycarbonyl-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2S,4aR,6aR,6aS,6bR,8aR,10S,12aR,14bR)-10-hydroxy-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-2,4a-dicarboxylic acid | present | LOTUS | |
| (2S,4aR,6aR,6aS,6bR,8aR,10S,12aR,14bR)-2-methoxycarbonyl-2,6a,6b,9,9,12a-hexamethyl-10-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2S,4aS,6aS,6aS,6bR,8aR,10R,12aR,14bR)-10-[(2R,3R,4R,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-2-methoxycarbonyl-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2S,4aS,6aS,6aS,6bR,8aR,10S,12aR,14bR)-10-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-methoxycarbonyl-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| 2,3,23-Trihydroxy-29-methoxy-29-oxoolean-12-en-28-oic acid | present | LOTUS |
05DNA & barcoding43 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phytolacca icosandra has left across the world's sequence archives.
At a glance
DNA specimens43
Marker genes5
GenBank sequences10
eDNA detections19
Countries3
The DNA barcodea real sequence read deposited for this species
TCGAAACCTGCCCAGCAGAACGACCCGCGAACATGTCATTACACATCGGGAGGGGCATCTGTTGCCCTCGGGCTTCGGCCACCCCTCCTC …
Phytolacca icosandra voucher UC304752 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Phytolacca icosandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidydiploid inferred
Chromosome records18–362n range36median36mode4records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 363×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-fedorov — Sugiura 1936a, b, 1939b
CCDB · book-fedorov — BOCHMOBH'l 1965
CCDB · book-atlas-flowering-plants — Sugiura 1936b
2n 181×CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Sugiura 1936a
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type5 148 records
Wild obs. + sensor2 980
Museum / vouchered2 159
Other9
Origin
Native2
Range
Area of Occupancy AOO10 440 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 1 504≤1 km 389≤10 km 148>10 km 76
2 117 georeferenced · 863 without coordinates
Open the mapobservation + sensor2 980
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy91% within 1 km
≤100 m 1 004≤1 km 60≤10 km 92>10 km 17
1 173 georeferenced · 986 without coordinates
Open the institutions mapphysical evidence2 159
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions72 of 123 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Durango, MX | 462 |
| Mexico City, MX | 243 |
| Saint Louis, US | 210 |
| Mexico City, MX | 98 |
| Tuxtla Gutiérrez, MX | 60 |
| Ciudad de México, MX | 60 |
| Austin, US | 55 |
| Mérida, MX | 55 |
| Guasave, MX | 49 |
| Anchorage, US | 42 |
| Juriquilla, MX | 41 |
| Tapachula, MX | 40 |
| Chapingo, MX | 37 |
| Antiguo Cuscatlán, SV | 36 |
| Puebla, MX | 32 |
| Bronx, US | 31 |
| San Diego, US | 30 |
| Riverside, US | 27 |
| Berlin, DE | 24 |
| Autlán de Navarro, MX | 24 |
| Tuxtla Gutiérrez, MX | 23 |
| Universidad Nacional de Colombia (UNAL)location not on record | 20 |
| Zacatecas, MX | 19 |
| National Biodiversity Institute, Costa Ricalocation not on record | 17 |
| ASUlocation not on record | 16 |
| Miami, US | 15 |
| University of Stellenboschlocation not on record | 14 |
| Tampa, US | 14 |
| Toluca, MX | 13 |
| MEXUlocation not on record | 12 |
| Culiacán, MX | 11 |
| León, NI | 11 |
| Area de Conservacion Guanacastelocation not on record | 11 |
| Tlalnepantla, MX | 10 |
| Altos de Pipe, VE | 9 |
| Mexico City, MX | 8 |
| San Francisco de Campeche, MX | 7 |
| Giardini Botanici Hanburylocation not on record | 7 |
| Mérida, MX | 7 |
| Guatemala City, GT | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 6 |
| Universidad Industrial de Santander (UIS)location not on record | 6 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| Kew, GB | 6 |
| IEBlocation not on record | 5 |
| Austin, US | 5 |
| San José, CR | 5 |
| Ciudad de México, MX | 4 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 4 |
| CASlocation not on record | 4 |
| Universidad de Nariño (UdeNar)location not on record | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| BMlocation not on record | 4 |
| WTUlocation not on record | 4 |
| Irvine, US | 3 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 3 |
| Pondicherry, IN | 3 |
| Montecillo, Texcoco, MX | 3 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 3 |
| Taipei, TW | 3 |
| MAlocation not on record | 3 |
| NO DISPONIBLElocation not on record | 3 |
| Montréal, CA | 3 |
| Xiamen, CN | 3 |
| Chicago, US | 2 |
| TAIElocation not on record | 2 |
| Cambridge, US | 2 |
| La Paz, MX | 2 |
| Bloomington, US | 2 |
| The University of Arizonalocation not on record | 2 |
| San Luis Obispo, US | 2 |
| BAYLUlocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Aarhus, DK | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| HUAlocation not on record | 2 |
| Santa Barbara, US | 2 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 2 |
| Ann Arbor, US | 2 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 2 |
| MX | 2 |
| Ciudad de México, MX | 2 |
| HEMlocation not on record | 2 |
| UTPLlocation not on record | 1 |
| Glocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| Frankfurt am Main | 1 |
| Mexico City, MX | 1 |
| Guatemala, GT | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Linares, MX | 1 |
| Tepatitlán de Morelos, MX | 1 |
| Chicago, US | 1 |
| Wlocation not on record | 1 |
| Lima, PE | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Loja, EC | 1 |
| Claremont, US | 1 |
| University of Zhejianglocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Iquitos, PE | 1 |
| FLASlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Badajoz, ES | 1 |
| Chapel Hill, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| Beijing, CN | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Phoenix, US | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| South Kensington, GB | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Ensenada, MX | 1 |
| Villa de Etla, MX | 1 |
| OTSlocation not on record | 1 |
| New Haven, US | 1 |
| EL PASO, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
123 institutions · 2 089 of 2 159 vouchered records shown · 70 without an institution code
09Environmental DNA19 detections
Where the DNA of Phytolacca icosandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map3 countries0
Disturbed Coastal Chaparral
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.2 °C 14.5–25.2
Seasonal swing summer↔winter2.50 °C
Max temp (day)28.2 °C 19.0–29.2
Min temp (night)20.8 °C 10.5–22.2
Precipitation65.5 mm/mo 20.6–325
Air humidity63.6 % 58.8–70.5
Moisture balance-40.9 mm/mo -133–167
Vapour deficit932 Pa 659–1,171
Wind speed2.20 m/s 1.30–6.30
Cloud cover15.1 % 13.1–30.8
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.