Phytolacca dodecandra

L'Hér. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Phytolaccaceae/Phytolacca

At a glance

Occurrence records994

Data sources12

Biological traits28

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Phytolacca dodecandra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility994 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS44 compounds

Occurrence & distributionGBIF994 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Phytolacca dodecandra L'Hérit., por vezes referido pelo seu sinónimo taxonómico Sarcoca dodecandra, é um arbusto escandente nativo da África tropical e do sul e Madagáscar. A planta, conhecida pelo nome comum de endod, é cultivado há vários séculos no centro e leste da África, particularmente na Etiópia, onde é utilizada como fonte de sabão e como veneno para atordoar peixes. O extracto da sua seiva é tóxico para moluscos, o que o torna interessante no controlo de populações de caracóis de água doce, entre os quais as espécies que são vectores da bilharziose, e do mexilhão-zebra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Plant height4.5 m

Plant height max15.24 m

Plant height min1 m

Seed mass5.42 mg

Seed mass max6 mg

Seed mass min4.79 mg

Seed volume4.8 mm³

Seed volume max4.8 mm³

Seed volume min4.8 mm³

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typeself

Life formclimbing tuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Elevation max670 m

Elevation min5 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: climber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition44 compounds

Compounds documented for Phytolacca dodecandra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids30

Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids4

Betalain alkaloids3

Phenylethanoids1

RiPPs-Lanthipeptides1

Documented compounds44 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-1-[(2E)-2-[(2R)-2,6-dicarboxy-2,3-dihydro-1H-pyridin-4-ylidene]ethylidene]-6-hydroxy-5-[(2R,3S,4R,5S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydroindol-1-ium-2-carboxylate	present	LOTUS
(2S)-1-[2-[(2S)-2,6-dicarboxy-2,3-dihydro-1H-pyridin-4-ylidene]ethylidene]-6-hydroxy-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydroindol-1-ium-2-carboxylate	present	LOTUS
(2S,4aR,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-hydroxy-2-methoxycarbonyl-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(2S,4aR,6aR,6aS,6bR,8aR,10S,12aR,14bS)-2-formyl-10-hydroxy-2,6a,6b,9,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(2S,4aR,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-2-formyl-10-hydroxy-9-(hydroxymethyl)-2,6a,6b,9,12a-pentamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,10R,11S,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-11-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,10R,11S,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-4-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-11-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,10R,11S,12aR,14bS)-11-hydroxy-10-[(2R,3R,4S,5S,6R)-4-hydroxy-6-(hydroxymethyl)-3,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-3,5-dihydroxy-6-(hydroxymethyl)-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxyoxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(4aS,6aR,6aS,6bR,8aR,10S,12aR,14bS)-10-[(2R,3R,4S,5R,6R)-4-[(2S,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phytolacca dodecandra has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKM491870.1 ↗624 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGTGAACACGTTATCACACATCGAGAGGGGCATTTGTTGCCCTTGGGCCTCGGCCACCTCTCCCT …

Phytolacca dodecandra voucher R. E. S. Tanner 572 (UC) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phytolacca dodecandra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 361×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Auquier & Renard 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type994 records

Wild obs. + sensor100

Museum / vouchered894

Range

Area of Occupancy AOO1 776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 30≤1 km 9≤10 km 1>10 km 2

42 georeferenced · 58 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 1≤1 km 5≤10 km 46>10 km 26

78 georeferenced · 816 without coordinates

Open the institutions mapphysical evidence894

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 69 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	115
MeiseBGlocation not on record	90
Saint Louis, US	84
BAYLUlocation not on record	66
Kew, GB	42
WAGlocation not on record	35
Pretoria, ZA	32
Durban, ZA	30
Yaoundé, CM	26
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	24
Addis Ababa, ET	20
TAFORI-LSRClocation not on record	20
Haramaya Universitylocation not on record	19
Clocation not on record	15
Plocation not on record	15
Adam Mickiewicz University in Poznańlocation not on record	10
Uppsala, SE	10
Instituto de Investigação Científica Tropicallocation not on record	8
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	8
University of Stellenboschlocation not on record	8
Glocation not on record	5
EAlocation not on record	5
Stockholm, SE	5
CJBGlocation not on record	5
Leiden University Medical Centerlocation not on record	4
MAlocation not on record	4
Bronx, US	4
Berlin, DE	4
Xiamen, CN	4
UnBlocation not on record	4
Arusha, TZ	3
Phoenix, US	3
FTlocation not on record	3
UNESP-FCAlocation not on record	2
LDlocation not on record	2
Cape Town, ZA	2
Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record	2
CASlocation not on record	2
Coimbra, PT	2
MHUlocation not on record	2
BRLUlocation not on record	2
Limbe Botanical & Zoological Gardenslocation not on record	2
IPHAMETRAlocation not on record	1
National Range Agencylocation not on record	1
ex-Centro Nacional de Investigação Cientifica (CNIC)location not on record	1
Botanic Gardenlocation not on record	1
Chongqing Museumlocation not on record	1
Mlocation not on record	1
MEXUlocation not on record	1
LGlocation not on record	1
LUAlocation not on record	1
Elocation not on record	1
Montpellier, FR	1
GENTlocation not on record	1
Chicago, US	1
Llocation not on record	1
Forestry Research Institute of Nigerialocation not on record	1
FIlocation not on record	1
Goucher Collegelocation not on record	1
Tallinn Botanic Gardenlocation not on record	1
LISClocation not on record	1
LBVlocation not on record	1
Agricultural Research Centerlocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
Zlocation not on record	1
Dresden, DE	1
MSB-3054location not on record	1
Claremont, US	1

69 institutions · 775 of 894 vouchered records shown · 119 without an institution code

09Environmental DNA1 detections

Where the DNA of Phytolacca dodecandra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)