Phytocoris populi

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Phytocoris

At a glance

Occurrence records589

Data sources7

Biological traits0

DNA specimens20

eDNA detections196

Sources7 archives

Databases and archives Phytocoris populi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility589 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI196 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF589 records

Environmental DNA4 datasets · 7 countries196 detections

DNA & barcodingBOLD20 specimens

01Narrative

Phytocoris populi is a species of plant bugs belonging to the family Miridae, subfamily Mirinae. It is widespread in Europe but absent from Albania, Andorra, Azores, Canary Islands, Cyprus, Faroe Islands and Iceland. then across the Palearctic to the Russian Far East and Siberia. Phytocoris populi lives on various deciduous trees, especially on poplars ( Populus ) and willows (Salix ), more rarely on linden trees ( Tilia ), birches ( Betula ), alders ( Alnus ), ash trees ( Fraxinus ) or fruit trees. Both the nymphs and the imagines sit during the day predominantly in cracks of the bark on the trunk of the host plants. They feed predominantly as predators on aphids , psyllids, Psocoptera and other small invertebrates that live on the trunk of the plants. The adult bugs can be observed from July to September. They are very active in flight.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phytocoris populi has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections196

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.21%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 8 variable positions, in barcode order

86Gmostly conserved

206Cmostly conserved

238Amostly conserved

316Gmostly conserved

415Amostly conserved

469Gmostly conserved

556Gmostly conserved

563Gmostly conserved

CACTCTATATTTTATTTTTGGATTATGAGCAGGAATATTAGGAACATCACTAAGATGAATCATTCGAATCGAATTAGGAATACCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phytocoris dimidiatussame genus7.6%Phytocoris pinisame genus9.9%Phytocoris neglectussame genus10.0%Phytocoris tiliaesame genus10.2%Phytocoris uniformissame genus10.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type589 records

Wild obs. + sensor298

Museum / vouchered277

Other14

Range

Area of Occupancy AOO1 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 130≤1 km 69≤10 km 70>10 km 13

282 georeferenced · 16 without coordinates

Open the mapobservation + sensor298

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 159≤1 km 31≤10 km 61>10 km 1

252 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence277

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	38
CBDClocation not on record	25
Natural History Museum, Aarhus Denmarklocation not on record	16
SLU Artdatabankenlocation not on record	14
NCMGlocation not on record	13
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	7
Philadelphia, US	7
Norwegian Institute of Bioeconomy Researchlocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	3
BioFokuslocation not on record	3
Helsinki, FI	2
Metsähallituslocation not on record	1
National Institute of Biological Resourceslocation not on record	1
Tartu, EE	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Winterthur, CH	1
ZMAAlocation not on record	1
Bonn, DE	1

18 institutions · 139 of 277 vouchered records shown · 138 without an institution code

09Environmental DNA196 detections

Where the DNA of Phytocoris populi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found196

Studies independent surveys4

Countries7

Verifiable raw sequence linked176

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 196 detections have coordinates

Open the map7 countries0

HerbsForestForest edge (suburban)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 12.5–17.0

Seasonal swing summer↔winter18.4 °C

Max temp (day)18.5 °C 14.9–20.9

Min temp (night)10.6 °C 8.90–13.6

Precipitation81.7 mm/mo 53.7–105

Air humidity60.5 % 57.3–62.9

Moisture balance-27.3 mm/mo -75.2–26.4

Vapour deficit667 Pa 550–762

Wind speed2.80 m/s 2.30–4.00

Cloud cover47.3 % 39.9–55.0

CHELSA 1981–2010, ~9 km grid, at location & month of 196 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)