Phyteuma scheuchzeri

All. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Phyteuma

At a glance

Occurrence records2 674

Data sources8

Biological traits25

DNA specimens3

eDNA detections14

Sources8 archives

Databases and archives Phyteuma scheuchzeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 674 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF2 674 records

Environmental DNA1 datasets · 3 countries14 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Ко́льник Ше́йхцера — вид цветковых растений рода Кольник (Phyteuma) семейства Колокольчиковые (Campanulaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYLEDAGIFTWCVP

Size & morphology6

Plant height0.125 m

Plant height max0.45 m

Plant height min0.1 m

Seed mass0.04 mg

Seed mass max0.04 mg

Seed mass min0.04 mg

Life cycle & reproduction6

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Lifespan years13 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry5

Leaf C:N ratio25.97 g/g

Leaf c491 mg/g

Leaf dry-matter content (LDMC)195 mg/g

Leaf n18.93 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typeone-seeded generative dispersule

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyteuma scheuchzeri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections14

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMK652062.1 ↗350 bp

ACGT

TTAGGCCGAGGGCACGTCTGCATGGGCGTCACGCATCGCGTCGCCCCCAAAAAACAGCTTGCACTTCCATGTGCTTGCTAGCTTGATGGG …

Phyteuma scheuchzeri isolate BOP104908 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyteuma scheuchzeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–362n range26median26mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 266×CCDB · fl-europaea · CCDB · book-ipcn66 · CCDB · book-fedorov

CCDB · fl-europaea — Contandriopoulos,

CCDB · book-ipcn66 — Gadella 1966b

CCDB · book-fedorov — Marchal 1920

CCDB · book-fedorov — Contandriopoulos 1962

CCDB · book-fedorov — Favarger (Contandriopoulos 1962)

CCDB · book-fedorov — Gadella 1966

2n 362×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Rosen 1931

CCDB · book-atlas-flowering-plants — Rosen 1931

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 674 records

Wild obs. + sensor2 496

Museum / vouchered163

Cultivated / captive3

Other12

Origin

Introduced10

Range

Area of Occupancy AOO3 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 552≤1 km 123≤10 km 1 444>10 km 18

2 137 georeferenced · 359 without coordinates

Open the mapobservation + sensor2 496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 1≤1 km 11≤10 km 50>10 km 2

64 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence163

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	36
Zürich, CH	33
Bern, CH	18
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	15
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	11
LDlocation not on record	9
Institut und Museum fuer Geologie und Palaeontologielocation not on record	9
Oskarshamn, SE	7
GJOlocation not on record	3
South Kensington, GB	2
Porrentruy, CH	2
BClocation not on record	2
Wlocation not on record	2
CJBGlocation not on record	1
Berlin, DE	1
Sion, CH	1
Fribourg, CH	1
Bergen, NO	1
Dresden, DE	1
BRNUlocation not on record	1
Universität Göttingenlocation not on record	1
Barcelona, ES	1
Salzburg, AT	1
Flagstaff, US	1
Chongqing Museumlocation not on record	1
BIO-UNIPIlocation not on record	1
PRClocation not on record	1

27 institutions · 163 of 163 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Phyteuma scheuchzeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C -2.50–14.5

Seasonal swing summer↔winter19.6 °C

Max temp (day)18.9 °C 0.9–18.9

Min temp (night)9.30 °C -7.30–9.30

Precipitation72.2 mm/mo 72.2–175

Air humidity58.3 % 58.3–60.2

Moisture balance-20.6 mm/mo -20.6–118

Vapour deficit782 Pa 219–782

Wind speed2.60 m/s 2.60–6.90

Cloud cover40.9 % 40.9–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyteuma scheuchzeri

At a glance

Sources8 archives

Size & morphology6

Life cycle & reproduction6

Diet & foraging1

Habitat & environment6

Physiology & chemistry5

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 674 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 27 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 674 records