Phyteuma ovatum

Honck. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Phyteuma

At a glance

Occurrence records6 924

Data sources8

Biological traits28

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Phyteuma ovatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 924 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF6 924 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 26

01Narrative

Phyteuma ovatum, la raiponce ovoïde, raiponce ovale ou raiponce de Haller, est une plante herbacée vivace de la famille des Campanulacées appartenant au genre Phyteuma. Synonyme : - Phyteuma halleri All. - la raiponce de Haller.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology8

Plant height0.375 m

⚠ sources differ — GIFT: 0.375 m · LEDA: 0.375 m · TRY: 0.4 m

Plant height generative0.5 m

Plant height max1 m

Plant height min0.3 m

Seed length0.9 mm

Seed mass0.163 mg

⚠ sources differ — TRY: 0.163 mg · LEDA: 0.067 mg · GIFT: 0.152 mg

Seed mass max0.18 mg

Seed mass min0.18 mg

Life cycle & reproduction8

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeself

Flowering endAug

Flowering startJun

Life formperennial

Life spanperennial

Lifespan years10 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry5

Leaf C:N ratio12.94 g/g

Leaf c461 mg/g

Leaf dry-matter content (LDMC)117 mg/g

Leaf n35.61 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typeseed

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyteuma ovatum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC455569.1 ↗704 bpItaly

ACGT

TCGAACCCTGCATAGCAGAACAACCGGAACACGTTGAAAAACACATTCTGGGTATGTGTGTTCGGGATTAGGCGATAGCCCCCCGTGTAC …

Phyteuma ovatum voucher WU:P. Sch nswetter & A. Tribsch 4581 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyteuma ovatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records22–262n range26median26mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 264×CCDB · fl-europaea · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · fl-europaea — Contandriopoulos,

CCDB · book-fedorov — Sugiura 1941, 1942b

CCDB · book-fedorov — Contandriopoulos 1962

CCDB · book-atlas-flowering-plants

2n 222×CCDB · fl-europaea · CCDB · book-ipcn66

CCDB · fl-europaea — Polatschek, 1966

CCDB · book-ipcn66 — Polatschek 1966

n 111×CCDB · book-ipcn66

CCDB · book-ipcn66 — Polatschek 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.999 ↗

08Occurrence & distribution

Record type6 924 records

Wild obs. + sensor6 632

Museum / vouchered282

Other10

Origin

Introduced1

Range

Area of Occupancy AOO7 696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 1 233≤1 km 298≤10 km 4 048>10 km 173

5 752 georeferenced · 880 without coordinates

Open the mapobservation + sensor6 632

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 8≤1 km 34≤10 km 102>10 km 2

146 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence282

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BFLlocation not on record	39
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	29
Zürich, CH	28
GJOlocation not on record	21
Salzburg, AT	13
LDlocation not on record	13
Bern, CH	13
Glarus, CH	11
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	11
BRNUlocation not on record	10
SZUlocation not on record	9
BIO-UNIPIlocation not on record	8
Provincia di Livornolocation not on record	7
Paris, FR	7
Zürich, CH	7
San Jose State University, Museum of Birds and Mammalslocation not on record	5
Oskarshamn, SE	4
Görlitz, DE	3
Mlocation not on record	3
BClocation not on record	3
Wlocation not on record	2
Moscow State Universitylocation not on record	2
Porrentruy, CH	2
Dresden, DE	1
Berlin, DE	1
Saint Louis, US	1
MeiseBGlocation not on record	1
Columbia, US	1
Natural History Museum Rotterdamlocation not on record	1
Barcelona, ES	1
Pamplona, ES	1
GZUlocation not on record	1
ULBF-AGRlocation not on record	1

33 institutions · 260 of 282 vouchered records shown · 20 without an institution code

09Environmental DNA3 detections

Where the DNA of Phyteuma ovatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.00 °C -0.8–12.8

Seasonal swing summer↔winter19.3 °C

Max temp (day)9.90 °C 2.70–17.1

Min temp (night)1.00 °C -5.60–7.60

Precipitation124 mm/mo 82.5–165

Air humidity59.3 % 58.5–60.0

Moisture balance48.9 mm/mo -6.70–104

Vapour deficit500 Pa 275–726

Wind speed4.70 m/s 3.00–6.40

Cloud cover43.8 % 41.4–46.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyteuma ovatum

At a glance

Sources8 archives

Size & morphology8

Life cycle & reproduction8

Diet & foraging1

Habitat & environment5

Physiology & chemistry5

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 924 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 924 records