Physella gyrina

(Say, 1821) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Physidae/Physella

At a glance

Occurrence records3 930

Data sources9

Biological traits2

DNA specimens267

eDNA detections140

Sources9 archives

Databases and archives Physella gyrina's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 930 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI140 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics267 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 930 records

Environmental DNA2 datasets · 2 countries140 detections

DNA & barcodingBOLD267 specimens

01Narrative

The Fish Lake physa, scientific name Physella microstriata, was a species of air-breathing freshwater snail, an aquatic gastropod mollusk in the family Physidae. This species was endemic to the United States. It is now extinct.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

05DNA & barcoding267 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Physella gyrina has left across the world's sequence archives.

At a glance

DNA specimens267

BINs6

Marker genes2

eDNA detections140

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P646 bp consensus225 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 75% of positions are identical in every specimen.

Where individuals differ — all 162 variable positions, in barcode order

2Tvariable

3Tmostly conserved

5Gmostly conserved

6Gmostly conserved

7Tmostly conserved

8Gvariable

9Tmostly conserved

10Tmostly conserved

11Tmostly conserved

13Avariable

14Tmostly conserved

15Gmostly conserved

16Tmostly conserved

17Gmostly conserved

18Gmostly conserved

19Tmostly conserved

20Tmostly conserved

21Tmostly conserved

22Avariable

23Gmostly conserved

24Tvariable

25Tmostly conserved

26Gmostly conserved

27Gmostly conserved

28Tmostly conserved

29Avariable

30Cvariable

31Amostly conserved

32Gvariable

33Gmostly conserved

34Tmostly conserved

35Tmostly conserved

36Tmostly conserved

37Amostly conserved

38Avariable

39Gvariable

40Tvariable

41Tvariable

42Tmostly conserved

43Amostly conserved

44Cvariable

45Tmostly conserved

46Amostly conserved

47Avariable

48Tmostly conserved

49Tvariable

50Cvariable

51Gvariable

52Amostly conserved

53Tmostly conserved

54Tmostly conserved

55Avariable

56Gmostly conserved

57Avariable

58Gmostly conserved

59Tvariable

60Tmostly conserved

61Gvariable

62Gmostly conserved

63Gmostly conserved

64Amostly conserved

65Amostly conserved

66Cmostly conserved

67Tvariable

68Amostly conserved

69Cmostly conserved

70Amostly conserved

71Tmostly conserved

73Amostly conserved

74Gmostly conserved

76Tmostly conserved

77Tmostly conserved

78Tmostly conserved

79Amostly conserved

80Tmostly conserved

81Tmostly conserved

82Amostly conserved

85Cmostly conserved

97Tmostly conserved

103Tmostly conserved

112Avariable

121Tmostly conserved

127Tmostly conserved

136Tvariable

166Avariable

172Gmostly conserved

184Tmostly conserved

187Gvariable

191Cmostly conserved

202Tmostly conserved

205Gmostly conserved

214Tmostly conserved

223Amostly conserved

245Tmostly conserved

247Amostly conserved

248Cmostly conserved

250Amostly conserved

256Amostly conserved

268Avariable

274Gmostly conserved

280Tmostly conserved

283Amostly conserved

292Amostly conserved

298Gmostly conserved

304Tmostly conserved

310Tmostly conserved

316Amostly conserved

317Gvariable

319Tvariable

322Cvariable

325Tmostly conserved

329Tmostly conserved

334Tmostly conserved

341Amostly conserved

343Tmostly conserved

352Tvariable

355Gmostly conserved

358Tmostly conserved

361Amostly conserved

364Tmostly conserved

+42 more variable positions not shown

TTTTGGTGTTTGATGTGGTTTAGTTGGTACAGGTTTAAGTTTACTAATTCGATTAGAGTTGGGAACTACATTAGTTTTATTAGACGAACA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.2%

Haplotypes9

BINs6

Most divergent pair3.1%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Galba schirazensissame order14.1%Planorbula armigerasame order14.6%Galba humilissame order14.9%Galba cousinisame order14.9%Galba mweruensissame order15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type3 930 records

Wild obs. + sensor459

Museum / vouchered3 463

Fossil3

Other5

Range

Area of Occupancy AOO10 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 393≤1 km 19≤10 km 27>10 km 1

440 georeferenced · 19 without coordinates

Open the mapobservation + sensor459

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 26≤1 km 269≤10 km 553>10 km 195

1 043 georeferenced · 2 420 without coordinates

Open the institutions mapphysical evidence3 463

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	836
Ann Arbor, US	637
Cambridge, US	634
Champaign, US	385
Chicago, US	317
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	215
Delaware Museum of Nature and Sciencelocation not on record	83
Chongqing Museumlocation not on record	62
University of Minnesota, James Ford Bell Museum of Natural Historylocation not on record	48
Washington, US	39
Toronto, CA	36
North Carolina Museum of Natural Scienceslocation not on record	29
Victoria, CA	26
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	22
Santa Barbara Museum of Natural Historylocation not on record	21
Natural History Museum of Utahlocation not on record	15
Chicago, US	12
Saint John, CA	5
Paleontological Research Institutionlocation not on record	4
CASlocation not on record	4
Los Angeles, US	2
Natural History Museum, Londonlocation not on record	2
Denver, US	2
South Kensington, GB	2
Salzburg, AT	1
CBDClocation not on record	1
University of Guelphlocation not on record	1
Tromsø, NO	1
Centre for Biodiversity Genomicslocation not on record	1
State University of New York Buffalo State College, Great Lakes Centerlocation not on record	1
Alabama Museum of Natural Historylocation not on record	1
EL PASO, US	1

32 institutions · 3 446 of 3 463 vouchered records shown · 17 without an institution code

09Environmental DNA140 detections

Where the DNA of Physella gyrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found140

Studies independent surveys2

Countries2

Verifiable raw sequence linked111

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 140 detections have coordinates

Open the map2 countries0

LakeRiverStreamLake Nearshore

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C -2.80–17.2

Seasonal swing summer↔winter23.4 °C

Max temp (day)17.7 °C 0.9–21.1

Min temp (night)11.7 °C -6.10–14.6

Precipitation107 mm/mo 81.3–129

Air humidity61.5 % 59.2–65.0

Moisture balance18.6 mm/mo -51.0–91.8

Vapour deficit587 Pa 197–751

Wind speed2.40 m/s 1.80–6.00

Cloud cover51.9 % 43.8–65.9

CHELSA 1981–2010, ~9 km grid, at location & month of 137 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Physella gyrina

At a glance

Sources9 archives

Habitat & environment2

At a glance

Record type3 930 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 930 records