Physcia magnussonii

Frey · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Caliciales/Physciaceae/Physcia

At a glance

Occurrence records281

Data sources6

Biological traits1

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Physcia magnussonii's data was compiled from.

GBIFGlobal Biodiversity Information Facility281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF281 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Physcia magnussonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK811875.1 ↗497 bpNorway · 2013

ACGT

AAGGATCATTATCGAGAGACGGGGTCTAACCGGCCTCAACTCTTCATCCGTGTCTACATACCAATGTTGCTTTGGCGAGCCTCGGGCTTG …

Physcia magnussonii voucher O-L-197861 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type281 records

Wild obs. + sensor126

Museum / vouchered148

Other7

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 85≤1 km 8≤10 km 18>10 km 6

117 georeferenced · 9 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 27≤1 km 33≤10 km 17>10 km 2

79 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	25
Uppsala, SE	22
Trondheim, NO	20
University of Gdansklocation not on record	8
ASUlocation not on record	6
DOI/NPS, Colonial National Historical Parklocation not on record	5
SLU Artdatabankenlocation not on record	5
UNITOlocation not on record	5
BioFokuslocation not on record	4
WTUlocation not on record	4
CJBGlocation not on record	4
Clocation not on record	4
Madison, US	3
TSBlocation not on record	3
Bronx, US	3
Bergen, NO	3
LDlocation not on record	2
BG-NMNHSlocation not on record	2
Madrid, ES	2
Dhaka, BD	1
Helsinki, FI	1
Vancouver, CA	1
University of Oslo, Natural History Museumlocation not on record	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Salzburg, AT	1

25 institutions · 136 of 148 vouchered records shown · 12 without an institution code

09Environmental DNA3 detections

Where the DNA of Physcia magnussonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Pa svakt overhengende bergvegg (gneis, gamme…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median1.00 °C 1.00–1.00

Seasonal swing summer↔winter18.4 °C

Max temp (day)2.40 °C

Min temp (night)-4.00 °C

Precipitation66.7 mm/mo

Air humidity64.7 %

Moisture balance-13.9 mm/mo

Vapour deficit232 Pa

Wind speed5.60 m/s

Cloud cover44.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)