Physcia aipolia
(Ehrh. ex Humb.) Fürnr. · speciesAt a glance
Occurrence records20 972
Data sources10
Biological traits0
DNA specimens35
eDNA detections35
Sources10 archives
Databases and archives Physcia aipolia's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility20 972 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
Catalogue of LifeCOLtaxonomy↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Chemical compositionLOTUS6 compounds
Occurrence & distributionGBIF20 972 records
Environmental DNA2 datasets · 5 countries35 detections
DNA & barcodingBOLD · NCBI35 specimens
01Narrative
Physcia aipolia ist eine in Mitteleuropa häufigere Blattflechtenart, die Baumrinde besiedelt.
No narrative description available for this taxon yet.
02Traits & measurements
No structured trait data for this taxon yet.
03Chemical composition6 compounds
Compounds documented for Physcia aipolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Hopane and Moretane triterpenoids5
Depsides1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| [(2R,3R,3aS,5aR,5bR,7S,7aS,11aR,11bR,13aR,13bS)-7-hydroxy-3-(2-hydroxypropan-2-yl)-5a,5b,8,8,11a,13b-hexamethyl-1,2,3,3a,4,5,6,7,7a,9,10,11,11b,12,13,13a-hexadecahydrocyclopenta[a]chrysen-2-yl] acetate | present | LOTUS | |
| [(3S,3aS,4S,5aR,5bR,7S,7aS,11aR,11bR,13aR,13bR)-4-hydroxy-3-(2-hydroxypropan-2-yl)-5a,5b,8,8,11a,13b-hexamethyl-1,2,3,3a,4,5,6,7,7a,9,10,11,11b,12,13,13a-hexadecahydrocyclopenta[a]chrysen-7-yl] acetate | present | LOTUS | |
| [(3S,3aS,4S,5aR,5bR,7S,7aS,11aR,11bR,13aR,13bR)-7-acetyloxy-3-(2-hydroxypropan-2-yl)-5a,5b,8,8,11a,13b-hexamethyl-1,2,3,3a,4,5,6,7,7a,9,10,11,11b,12,13,13a-hexadecahydrocyclopenta[a]chrysen-4-yl] acetate | present | LOTUS | |
| [(3S,3aS,4S,5aR,5bR,7S,7aS,11aR,11bR,13aR,13bR)-7-hydroxy-3-(2-hydroxypropan-2-yl)-5a,5b,8,8,11a,13b-hexamethyl-1,2,3,3a,4,5,6,7,7a,9,10,11,11b,12,13,13a-hexadecahydrocyclopenta[a]chrysen-4-yl] acetate | present | LOTUS | |
| Atranorin | present | LOTUS | |
| Zeorin | present | LOTUS |
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Physcia aipolia has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes1
GenBank sequences10
eDNA detections35
Countries5
The DNA barcodea real sequence read deposited for this species
AGACGGGGTCTAACCGGCCCCACCTCCTCATCCGTGTCTACATACCAATGTTGCTTTGGCGGGCCTCGGGCTTGTTCTGGGGATTTCACA …
Physcia aipolia voucher SS0017 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★ITS10
fungal barcode
08Occurrence & distribution
Record type20 972 records
Wild obs. + sensor14 553
Museum / vouchered6 318
Cultivated / captive12
Other89
Origin
Native579
Range
Area of Occupancy AOO53 784 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 5 456≤1 km 3 114≤10 km 4 879>10 km 105
13 554 georeferenced · 999 without coordinates
Open the mapobservation + sensor14 553
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 433≤1 km 941≤10 km 1 031>10 km 284
2 689 georeferenced · 3 629 without coordinates
Open the institutions mapphysical evidence6 318
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 12 records without
Open the mapnot free-living12
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions75 of 158 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| St. Paul, US | 545 |
| Wuzhou, CN | 465 |
| Madison, US | 439 |
| Uppsala, SE | 376 |
| Olocation not on record | 373 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 212 |
| ASUlocation not on record | 198 |
| Philadelphia, US | 190 |
| LDlocation not on record | 148 |
| ILLSlocation not on record | 140 |
| TSBlocation not on record | 133 |
| Chicago, US | 108 |
| Museum of the Rockieslocation not on record | 96 |
| BDBClocation not on record | 93 |
| Trondheim, NO | 91 |
| MAlocation not on record | 89 |
| US | 88 |
| Entomological Society of Latvialocation not on record | 88 |
| Durham, US | 82 |
| Berlin, DE | 80 |
| Stockholm, SE | 77 |
| University of Gdansklocation not on record | 76 |
| BClocation not on record | 76 |
| Helsinki, FI | 74 |
| Bronx, US | 73 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 67 |
| Barcelona, ES | 65 |
| GZUlocation not on record | 65 |
| TROMlocation not on record | 62 |
| Bergen, NO | 61 |
| University of Stellenboschlocation not on record | 61 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 59 |
| Madrid, ES | 58 |
| Université Lavallocation not on record | 48 |
| València, ES | 47 |
| Edmonton, CA | 46 |
| CJBGlocation not on record | 44 |
| SLU Artdatabankenlocation not on record | 41 |
| UFMSlocation not on record | 36 |
| Ann Arbor, US | 36 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 34 |
| McWane Science Centerlocation not on record | 34 |
| ULBF-AGRlocation not on record | 33 |
| WTUlocation not on record | 31 |
| Mexico City, MX | 30 |
| Museo Achille Folettolocation not on record | 25 |
| FLASlocation not on record | 24 |
| Boise, US | 23 |
| Canberra, AU | 23 |
| MeiseBGlocation not on record | 23 |
| Salzburg, AT | 22 |
| Dhaka, BD | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Museo Entomologico de Leonlocation not on record | 19 |
| EL PASO, US | 19 |
| CLUlocation not on record | 18 |
| Albuquerque, US | 17 |
| Vancouver, CA | 16 |
| Lake Charles, US | 15 |
| Frauenfeld, CH | 15 |
| UNITOlocation not on record | 14 |
| Minia, EG | 14 |
| Toronto, CA | 14 |
| Knoxville, US | 13 |
| PHlocation not on record | 13 |
| Tallinn, EE | 12 |
| Santa Barbara, US | 12 |
| University of Western Ontariolocation not on record | 11 |
| Bozeman, US | 11 |
| University of Manitobalocation not on record | 10 |
| Forssa, FI | 10 |
| New Haven, US | 10 |
| Mlocation not on record | 10 |
| Vitoria, ES | 10 |
| Chinese Academy of Scienceslocation not on record | 10 |
| Chapel Hill, US | 10 |
| South Kensington, GB | 10 |
| Polar-Alpine Botanical Garden-Institutelocation not on record | 10 |
| BG-NMNHSlocation not on record | 9 |
| UoB-IBlocation not on record | 9 |
| Staatsarchiv Urilocation not on record | 9 |
| Lincoln, US | 9 |
| San Sebastián, ES | 9 |
| Yerevan, AM | 8 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 8 |
| nbflocation not on record | 7 |
| Uniwersytet Wrocławskilocation not on record | 7 |
| Clemson, US | 7 |
| Oregon State Universitylocation not on record | 6 |
| Oskarshamn, SE | 6 |
| Göteborg, SE | 5 |
| Fort Hayslocation not on record | 5 |
| Burlington, US | 5 |
| M-Lichenslocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Kensington, AU | 5 |
| University of Oslo, Natural History Museumlocation not on record | 5 |
| BioFokuslocation not on record | 4 |
| PUC-RSlocation not on record | 4 |
| Champaign, US | 4 |
| New Brunswick, US | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Repubblica di San Marinolocation not on record | 4 |
| Klostermuseum Disentislocation not on record | 4 |
| Turku, FI | 4 |
| Arcata, US | 3 |
| US | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| San Diego, US | 3 |
| Royal Ontario Museumlocation not on record | 3 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 3 |
| Weber State Universitylocation not on record | 3 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 3 |
| Bourges, FR | 3 |
| Porvoo, FI | 3 |
| Davis, US | 2 |
| Bureau of Land Management, Medford District Officelocation not on record | 2 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 2 |
| Tilburg, NL | 2 |
| WU-MYClocation not on record | 2 |
| Norwegian Institute of Bioeconomy Researchlocation not on record | 2 |
| Kew, GB | 2 |
| Chicago, US | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| UnBlocation not on record | 2 |
| San Luis Obispo, US | 2 |
| AUAlocation not on record | 2 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 2 |
| Clarksville, US | 2 |
| Fort Worth, US | 2 |
| AADClocation not on record | 2 |
| Swiss Federal Research Institute WSLlocation not on record | 1 |
| Morgantown, US | 1 |
| Kenai National Wildlife Refugelocation not on record | 1 |
| Adelaide, AU | 1 |
| GJOlocation not on record | 1 |
| Logan, US | 1 |
| Karlsruhe, DE | 1 |
| PRClocation not on record | 1 |
| Catholic University of Pekinglocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| NMBU:MINAlocation not on record | 1 |
| College Park, US | 1 |
| Slovak National Museumlocation not on record | 1 |
| CABI Bioscience Genetic Resource Collectionlocation not on record | 1 |
| Wellington, NZ | 1 |
| Clocation not on record | 1 |
| Mount Annan, AU | 1 |
| Auckland, NZ | 1 |
| Umeå Universitylocation not on record | 1 |
| Pocatello, US | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Museo di Storia Naturale di Venezia Giancarlo Ligabue | Natural History Museum of Venice Giancarlo Ligabuelocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Miami, US | 1 |
158 institutions · 6 124 of 6 318 vouchered records shown · 193 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA35 detections
Where the DNA of Physcia aipolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found35
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 35 detections have coordinates
Open the map5 countries0
Salix capreapaa kvister av paaulus tremulaOn trunk of Populus tremula
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.5 °C -2.30–11.6
Seasonal swing summer↔winter18.3 °C
Max temp (day)13.0 °C 0.1–14.7
Min temp (night)5.90 °C -5.80–6.60
Precipitation82.6 mm/mo 58.1–122
Air humidity63.8 % 56.7–64.4
Moisture balance-4.10 mm/mo -21.2–121
Vapour deficit459 Pa 189–547
Wind speed4.10 m/s 3.00–6.10
Cloud cover52.2 % 41.9–52.5
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.