Physalis peruviana
speciesAt a glance
Occurrence records18 336
Data sources15
Biological traits62
DNA specimens34
eDNA detections24
Sources15 archives
Databases and archives Physalis peruviana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility18 331 records↗
OBISOcean Biodiversity Information System5 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources62 traits
Chemical compositionFoodAtlas · LOTUS · NPASS171 compounds
Occurrence & distributionGBIF · OBIS18 336 records
Environmental DNA1 datasets · 5 countries24 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GIFT · GoaT6.5 Gbp
01Narrative
Le Coqueret du Pérou est une espèce du genre Physalis originaire d'Amérique du Sud et acclimatée en Afrique. Il ne faut pas la confondre avec Physalis pruinosa, appelé « cerise de terre » au Canada. Appartenant à la famille des Solanaceae, comme la tomate, la pomme de terre, le piment, l'aubergine, le poivron mais aussi des plantes toxiques telles que la douce-amère ou la jusquiame, elle n'est pas proche de la cerise ou de la groseille comme ses divers noms vernaculaires pourraient le faire penser. Plante très rameuse, ses tiges atteignent de 70 cm à un mètre. Le fruit est de la grosseur d'une cerise, jaune orange, juteux et de saveur légèrement acide. Il est contenu dans une sorte de sac membraneux et parcheminé de couleur jaune ambré.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVP
Size & morphology22
Fruit length23.5 mm
⚠ sources differ — AusTraits: 23.5 mm · GIFT: 13.75 mm
Fruit length max35 mm
Fruit length min10 mm
Fruit width17.5 mm
⚠ sources differ — AusTraits: 17.5 mm · GIFT: 13.75 mm
Fruit width max15 mm
Fruit width min10 mm
Leaf length60 mm
⚠ sources differ — AusTraits: 60 mm · GIFT: 105 mm
Leaf length max150 mm
Leaf length min60 mm
Leaf width40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 65 mm
Leaf width max100 mm
Leaf width min40 mm
Petiole length5 cm
Plant height0.945 m
⚠ sources differ — GIFT: 0.945 m · AusTraits: 1 m · TRY: 0.372 m
Plant height max2 m
Plant height min0.3 m
Seed length2 mm
⚠ sources differ — AusTraits: 2 mm · GIFT: 1.75 mm
Seed length max2 mm
Seed length min1.75 mm
Seed mass0.893 mg
Seed mass max0.9 mg
Seed mass min0.81 mg
Life cycle & reproduction18
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: variable
Dehiscenceindehiscent
Dispersal typeanimal
Flower colouryellow
Flower width max25 mm
Flower width min15 mm
Flowering endJul
Flowering startJun
Flowering timeyynnnnnnnnny
Life formperennial
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprouting capacitypartial_resprouting
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment17
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max3 700 m
Elevation mean1 700 m
Elevation min0 m
Epiphyteterrestrial
Fruit colouryellow
Fruit fleshinessfleshy
Fruit typeberry
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: shrub · TRY: Herb
Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeovate
Succulenceno
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: woody · LEDA: non-woody · GIFT: non-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)10.73 mm²/mg
⚠ sources differ — TRY: 10.73 mm²/mg · LEDA: 44.55 mm²/mg · GIFT: 44.55 mm²/mg
Other traits1
Seeds per fruit101-1000
03Chemical composition171 compounds
Compounds documented for Physalis peruviana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Ergostane steroids60
Flavonols11
Cinnamic acids and derivatives8
Flavones7
Simple phenolic acids6
Documented compounds171 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Dehydrovomifoliol | present | LOTUS | |
| (1R,2R,10R,11S,14R,15S,16R)-15-hydroxy-16-[(2R)-5-(hydroxymethyl)-4-methyl-6-oxo-2,3-dihydropyran-2-yl]-10,14,16-trimethyl-17-oxapentacyclo[13.2.2.01,14.02,11.05,10]nonadeca-4,6-dien-9-one | present | LOTUS | |
| (1R,2R,7R,10R,11S,14R,15S,16R)-16-[(2R)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]-15-hydroxy-10,14,16-trimethyl-7-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-17-oxapentacyclo[13.2.2.01,14.02,11.05,10]nonadec-4-en-9-one | present | LOTUS | |
| (1S,2R,4R,6R,8S,10R,12R,13R,16S,17S)-16-[(1S)-1-[(2S)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]-1-hydroxyethyl]-13,16-dihydroxy-2,17-dimethyl-5,9-dioxahexacyclo[10.7.0.02,8.04,6.08,10.013,17]nonadecan-3-one | present | LOTUS | |
| (1S,2R,6S,7R,9R,11R,12R,15S,16S)-15-[(1S)-1-[(2S)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]-1-hydroxyethyl]-6,12,15-trihydroxy-2,16-dimethyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-4-en-3-one | present | NPASS | |
| (1S,2R,6S,7R,9R,11R,12R,15S,16S)-6,12,15-trihydroxy-15-[(1S)-1-hydroxy-1-[(2R)-4-(hydroxymethyl)-5-methyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-2,16-dimethyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-4-en-3-one | present | LOTUS | |
| (1S,2R,7S,9R,11R,12R,15S,16S)-15-[(1S)-1-[(2R)-4,5-dimethyl-6-oxo-2,3-dihydropyran-2-yl]-1-hydroxyethyl]-12,15-dihydroxy-2,16-dimethyl-8-oxapentacyclo[9.7.0.02,7.07,9.012,16]octadec-4-ene-3,6-dione | present | LOTUS | |
| (1S,3R,4R,5R)-3-(3-(3,4-Dihydroxyphenyl)Prop-2-Enoyloxy)-1,4,5-Trihydroxycyclohexane-1-Carboxylic Acid | present | NPASS | |
| (1s,3r,4r,5r)-3-[3-(3,4-dihydroxyphenyl)-1-oxoprop-2-enoxy]-1,4,5-trihydroxy-1-cyclohexanecarboxylic acid | present | FoodAtlas | |
| (1S,4R,6S)-4-[(1S)-1-[(3R,8S,9S,10R,13S,14S,17R)-1-hydroxy-10,13-dimethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-17-yl]ethyl]-1,6-dimethyl-3,7-dioxabicyclo[4.1.0]heptan-2-one | present | LOTUS |
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Physalis peruviana has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes5
GenBank sequences10
eDNA detections24
Countries7
The DNA barcodea real sequence read deposited for this species
CATCGGGTTTCCGTAGGTGACCTGCGGAGGATCATTGTCGAAACCTGCGAAGCAGAGCGACCCGCGAACCTGTTTGAACACCGGGGAGGC …
Physalis peruviana voucher TK9i internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL3★rbcLa★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Physalis peruviana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 469 470 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Physalis peruviana6.47 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidy4× tetraploid · measured
Chromosome records24–722n range48median48mode21records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4815×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +3
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Panda, R. C. & K. G. R. Rao. 1983. Spontaneous chromosome fragmentation in cape gooseberry Physalis peruviana L. Cell Chromosome Res. 6: 9–10.
CCDB · ipcn-api-dl — Ganapathi, A., S. Sudhakaran & S. Kulothungan. 1991. The diploid taxon in Indian natural populations of Physalis L. and its taxonomic significance. Cytologia 56: 283–288.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · book-indian_vol1 — Vilmorin, R. de & Simonet, M. 1927a, 1928 ; Bhaduri, P.N. 1933 ; Delay, C. 1947 ; Baldwin, J.T. & Speese, B.M. 1951a ; Menzel, M.Y. 1951 ; Gottschalk, W. 1954c ; Shibata, K. 1962a ; Heiser, C.B. 1963 ; Baquar, S.R. 1967a ; Madhavadian, P. 1968 ; Gill, L.S. 1972
CCDB · book-fedorov — Vilmorin, Simonet 1927a, 1928
CCDB · book-fedorov — Bhaduri 1933
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Baldwin, Spease 1951b
CCDB · book-fedorov — Menzel 1951
CCDB · book-fedorov — Gottschalk 1954c
CCDB · book-fedorov — Shibata 1962 (I. 1963)
CCDB · book-fedorov — Heiser 1963a (I. 1963)
CCDB · book-atlas-flowering-plants — Menzel 1951
GIFT · GIFT (floras)
2n 245×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 · CCDB · book-fedorov +2
CCDB · book-ipcn67-71 — MADHAVADIAN, P. 1968. Chromosome numbers in South Indian Solanaceae. Caryologia 21: 343-347.
CCDB · book-indian_vol1 — Yamamoto, K. & Sakai, K. 1932
CCDB · book-fedorov — Yamamoto K., Sakai 1932
CCDB · book-atlas-flowering-plants — Yamamoto & S. '32
GIFT · GIFT (floras)
2n -481×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
2n 721×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 248×CCDB · iapt · CCDB · solan · CCDB · ipcn-api-dl +4
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · solan
CCDB · ipcn-api-dl — Shibata, K. 1962. Estudios citologicos de plantas colombianas silvestres y cultivadas. J. Agric. Sci. (Tokyo). 8: 49–62.
CCDB · book-ipcn72 — GILL, L.S. 1972. Chromosome numbers in West-Himalayan bicarpellate species II. Bull. Torrey Bot. Club 99: 36-38.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967. Cytomorphological studies in the family Solanaceae from West Pakistan. Genetica 38: 388-397
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · Cave1963 — Heiser 1963a; Shibata 1962
n 121×CCDB · Cave1956supp
CCDB · Cave1956supp — Gottschalk 1954b
n 361×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Bir, S. S., B. S. Gill & Y. S. Bedi. 1982. Cytopalynological studies on some members of Bignoniaceae from India. Indian J. Bot. 5: 7–12.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type18 336 records
Wild obs. + sensor15 636
Museum / vouchered2 538
Cultivated / captive63
Fossil2
Other97
Origin
Native45
Introduced815
Range
Area of Occupancy AOO36 404 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy80% within 1 km
≤100 m 7 967≤1 km 2 757≤10 km 2 516>10 km 210
13 450 georeferenced · 2 186 without coordinates
Open the mapobservation + sensor15 636
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy66% within 1 km
≤100 m 364≤1 km 227≤10 km 248>10 km 51
890 georeferenced · 1 648 without coordinates
Open the institutions mapphysical evidence2 538
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 62 without coordinates
Open the mapnot free-living63
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions113 of 232 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 177 |
| Olocation not on record | 105 |
| SLU Artdatabankenlocation not on record | 101 |
| Pretoria, ZA | 81 |
| MeiseBGlocation not on record | 77 |
| Kew, GB | 63 |
| Brisbane, AU | 63 |
| Museo Entomologico de Leonlocation not on record | 60 |
| Christchurch, NZ | 59 |
| Universidad de Nariño (UdeNar)location not on record | 57 |
| Bronx, US | 56 |
| Mount Annan, AU | 50 |
| Auckland, NZ | 50 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 48 |
| LDlocation not on record | 46 |
| South Kensington, GB | 45 |
| Paris, FR | 43 |
| Canberra, AU | 43 |
| Chicago, US | 38 |
| Oskarshamn, SE | 33 |
| BDBClocation not on record | 31 |
| Adelaide, AU | 29 |
| Universidad Nacional de Colombia (UNAL)location not on record | 28 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 26 |
| Smithfield, AU | 22 |
| Blumenau, BR | 20 |
| DBF-NHMDlocation not on record | 20 |
| Stockholm, SE | 19 |
| University of Stellenboschlocation not on record | 19 |
| Universidad de Caldas (UCaldas)location not on record | 18 |
| Durban, ZA | 18 |
| BISHlocation not on record | 17 |
| Wellington, NZ | 17 |
| Yaoundé, CM | 15 |
| Kensington, AU | 15 |
| Tartu, EE | 14 |
| Chongqing Museumlocation not on record | 14 |
| Hobart, AU | 13 |
| Mlocation not on record | 13 |
| TAFORI-LSRClocation not on record | 13 |
| Armidale, AU | 12 |
| Provincia di Livornolocation not on record | 12 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 12 |
| Taipei, TW | 11 |
| Porto Alegre, BR | 11 |
| Honolulu, US | 11 |
| Oulu, FI | 11 |
| WAGlocation not on record | 11 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 10 |
| Universidade Federale do Rio Grande do Sullocation not on record | 10 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 10 |
| Kunming, CN | 10 |
| QCNElocation not on record | 10 |
| Batemans Bay, AU | 9 |
| TAIElocation not on record | 9 |
| BIO-UNIPIlocation not on record | 9 |
| National Museums of Kenyalocation not on record | 9 |
| Bern, CH | 9 |
| Universidad de La Salle (La Salle)location not on record | 9 |
| UFMGlocation not on record | 9 |
| Moscow State Universitylocation not on record | 9 |
| Loja, EC | 8 |
| Xiamen, CN | 8 |
| València, ES | 8 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 8 |
| Berlin, DE | 8 |
| Córdoba, AR | 8 |
| Universidad Católica de Oriente (UCO)location not on record | 7 |
| Beijing, CN | 7 |
| Edinburgh, GB | 7 |
| Nijmegen, NL | 7 |
| John T. Waterhouse Herbariumlocation not on record | 7 |
| Universiti Sains Malaysialocation not on record | 7 |
| Haramaya Universitylocation not on record | 7 |
| BRNUlocation not on record | 7 |
| Nishihara, JP | 7 |
| Brussel, BE | 7 |
| Salzburg, AT | 7 |
| Karlsruhe, DE | 7 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 6 |
| Aarhus, DK | 6 |
| Altos de Pipe, VE | 6 |
| MAlocation not on record | 6 |
| BClocation not on record | 6 |
| Odawara, JP | 6 |
| Pondicherry, IN | 5 |
| Dresden, DE | 5 |
| Arequipa, PE | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Quito, EC | 5 |
| Puerto Ayora, EC | 5 |
| Cape Town, ZA | 5 |
| Santa Cruz de la Sierra, BO | 5 |
| UTPLlocation not on record | 5 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 5 |
| Addis Ababa, ET | 5 |
| Instituto de Investigação Científica Tropicallocation not on record | 5 |
| Chapel Hill, US | 5 |
| BFLlocation not on record | 5 |
| La Paz, BO | 5 |
| Vancouver, CA | 5 |
| Wollongong, AU | 5 |
| Göteborg, SE | 5 |
| Riobamba, EC | 4 |
| PRClocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Wuzhou, CN | 4 |
| CASlocation not on record | 4 |
| Cusco, PE | 4 |
| Plocation not on record | 4 |
| Rotorua, NZ | 4 |
| Leiden University Medical Centerlocation not on record | 4 |
| Uppsala, SE | 3 |
| FUVATESlocation not on record | 3 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| JBRJlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| Taipei, TW | 3 |
| Görlitz, DE | 3 |
| Palmerston, AU | 3 |
| Clocation not on record | 3 |
| Granada, ES | 3 |
| Turku, FI | 3 |
| Cochabamba, BO | 3 |
| Philadelphia, US | 3 |
| Miami, US | 3 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 3 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 3 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 3 |
| Baroda, IN | 3 |
| Barcelona, ES | 3 |
| UNICAMPlocation not on record | 3 |
| H-Dunkellocation not on record | 3 |
| Wlocation not on record | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| HUAlocation not on record | 3 |
| BMlocation not on record | 3 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 3 |
| Glocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Parkville, AU | 2 |
| Tsukuba, JP | 2 |
| CUVClocation not on record | 2 |
| Sucre, BO | 2 |
| Lausanne, CH | 2 |
| Jardín Botánico de Bogotá "José Celestino Mutis" (JBB)location not on record | 2 |
| Mexico City, MX | 2 |
| UChlocation not on record | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| arosemena tola, EC | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Bloomington, US | 2 |
| Namur, BE | 2 |
| Taipei, TW | 2 |
| Alicante, ES | 2 |
| Trondheim, NO | 2 |
| Elocation not on record | 2 |
| TUR-Alocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Brasília, BR | 1 |
| UFOPlocation not on record | 1 |
| Valparaiso, CL | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| BSBIlocation not on record | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| Cambridge, US | 1 |
| University of Oxfordlocation not on record | 1 |
| UEMlocation not on record | 1 |
| Jinghong, CN | 1 |
| Circulo Herpetologico de Panamalocation not on record | 1 |
| Njala Universitylocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| UNESClocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| South African National Biodiversity Institute, The National Herbariumlocation not on record | 1 |
| Masindi, UG | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| EAlocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| FTlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| ESP026location not on record | 1 |
| UFSMlocation not on record | 1 |
| München, DE | 1 |
| Corrientes, AR | 1 |
| Pullman, US | 1 |
| H-Hohlalocation not on record | 1 |
| Zürich, CH | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Guangzhou, CN | 1 |
| San Isidro, AR | 1 |
| H-Meierottlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Davis, US | 1 |
| University of Johannesburglocation not on record | 1 |
| PHlocation not on record | 1 |
| Badajoz, ES | 1 |
| Umeå Universitylocation not on record | 1 |
| Nanjing, CN | 1 |
| Tampa, US | 1 |
| The CB Rhizobium Collectionlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| Iquitos, PE | 1 |
| Bangkok, TH | 1 |
| UDESC-CAVlocation not on record | 1 |
| Chengdu, CN | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| LISClocation not on record | 1 |
| Dekalb, US | 1 |
| Cincinnati, US | 1 |
| Dublin, IE | 1 |
| KMNlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| EL PASO, US | 1 |
| La Trobe Universitylocation not on record | 1 |
| Agricultural Research Centerlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Santiago de Cali, CO | 1 |
| Moscow, US | 1 |
| UNIVILLElocation not on record | 1 |
232 institutions · 2 381 of 2 538 vouchered records shown · 149 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Physalis peruviana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map5 countries0
Esc. cult. H. dry clay soil.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.2 °C 10.1–22.9
Seasonal swing summer↔winter21.2 °C
Max temp (day)18.6 °C 13.5–28.1
Min temp (night)10.8 °C 7.30–16.0
Precipitation70.0 mm/mo 25.0–77.3
Air humidity59.8 % 48.0–64.7
Moisture balance-15.5 mm/mo
Vapour deficit752 Pa 441–1,469
Wind speed3.20 m/s
Cloud cover41.4 % 21.3–58.3
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.