Physalis angulata
speciesAt a glance
Occurrence records13 315
Data sources16
Biological traits55
DNA specimens30
eDNA detections24
Sources16 archives
Databases and archives Physalis angulata's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 315 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics30 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionLOTUS · NPASS224 compounds
Occurrence & distributionGBIF13 315 records
Environmental DNA1 datasets · 5 countries24 detections
DNA & barcodingBOLD · NCBI30 specimens
Genome at a glanceCCDB · GIFT2n = 24
01Narrative
Physalis minima is a species of perennial herbs belonging to the family Solanaceae. Native gooseberry, wild cape gooseberry and pygmy groundcherry are some of the popular common names in English. It is a pantropical annual herb 20–50 cm high at its maturity. It can be found near the marshes of Java. Leaves are soft and smooth (not furry), with entire or jagged margins, 2.5–12 cm long. Cream to yellowish flowers are followed by edible yellowish fruit encapsulated in papery cover which turns straw brown and drops to the ground when the fruit is fully ripe. P. minima fruit The plant tends to have a weedy character, often found growing in disturbed sites.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsLEDAGIFT
Size & morphology22
Fruit length8 mm
⚠ sources differ — AusTraits: 8 mm · GIFT: 9 mm
Fruit length max12 mm
Fruit length min6 mm
Fruit width11 mm
⚠ sources differ — AusTraits: 11 mm · GIFT: 22.5 mm
Fruit width max12 mm
Fruit width min12 mm
Inflorescence length max500 cm
Leaf length60 mm
⚠ sources differ — AusTraits: 60 mm · GIFT: 35 mm
Leaf length max60 mm
Leaf length min20 mm
Leaf width30 mm
Leaf width max40 mm
Leaf width min5 mm
Petiole length6 cm
Plant height0.525 m
⚠ sources differ — GIFT: 0.525 m · AusTraits: 0.7 m · TRY: 0.5 m
Plant height max3 m
Plant height min0 m
Seed length1.5 mm
Seed length max1 mm
Seed mass0.56 mg
⚠ sources differ — TRY: 0.56 mg · AusTraits: 0.973 mg · GIFT: 0.693 mg
Seed mass max0.84 mg
Seed mass min0.48 mg
Life cycle & reproduction15
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal type detailedanemochorous
Flower colouryellow
Flowering endMay
Flowering startMay
Flowering timeyyyyyynnnnnn
Life formannual
Life spanannual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max3 400 m
Elevation mean1 383 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf shapeovate
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
03Chemical composition224 compounds
Compounds documented for Physalis angulata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Ergostane steroids156
Flavonols9
Flavones8
Tropane alkaloids8
Carotenoids (C40, β-β)5
Documented compounds224 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (16S,22R)-14alpha,17alpha-Epoxy-7alpha,13,14,20,22-pentahydroxy-1,15-dioxo-16,24-cyclo-13,14-secoergosta-2,5,25(27)-triene-18,26-dioic acid 18,20 | present | LOTUS | |
| (1R,2R,4R,5R,7S,10R,11S,14R,17S,18R,19S,20S,22R,25S)-4,14-dihydroxy-10,17,20-trimethyl-16,23,27,28-tetraoxanonacyclo[16.9.1.11,19.02,11.05,7.05,10.014,18.017,22.020,25]nonacosane-9,15,24,29-tetrone | present | LOTUS | |
| (1R,2R,4R,5R,8S,11R,13S,14S,15R,16S,19S,22S,23R,25S)-2,19-dihydroxy-13,16,23-trimethyl-6,10,17,26,27,30-hexaoxanonacyclo[23.2.2.15,14.15,15.01,23.04,22.08,13.011,16.015,19]hentriacont-28-ene-9,18,24,31-tetrone | present | LOTUS | |
| (1R,2R,4R,6S,11R,12R,15R,18R,19R,20S,21S,23R,26S)-15-hydroxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo[17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26]triacont-8-ene-10,16,25,30-tetrone | present | LOTUS | |
| (1R,2R,4R,6S,11R,12S,15R,18S,19R,20S,21R,23R,26S)-15-hydroxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo[17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26]triacont-8-ene-10,16,25,30-tetrone | present | LOTUS | |
| (1R,2R,4R,6S,11R,12S,15R,18S,19R,20S,21S,23R,26S)-15-hydroxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo(17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26)triacont-8-ene-10,16,25,30-tetrone | present | LOTUS | |
| (1R,2R,4R,6S,11R,12S,15S,18S,19R,20S,21S,23S,26S)-15-hydroxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo[17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26]triacont-8-ene-10,16,25,30-tetrone | present | LOTUS | |
| (1R,2R,4R,6S,8S,11R,12S,15R,18S,19R,20S,21S,23R,26S)-8-ethoxy-15-hydroxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo[17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26]triacontane-10,16,25,30-tetrone | present | LOTUS | |
| (1R,2R,4R,6S,8S,11R,12S,15S,18S,19R,20S,21R,23R,26S)-15-hydroxy-8-methoxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo[17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26]triacontane-10,16,25,30-tetrone | present | LOTUS | |
| (1R,2R,4R,6S,8S,11R,12S,15S,18S,19R,20S,21S,23R,26S)-15-hydroxy-8-methoxy-11,18,21-trimethyl-5,17,24,28,29-pentaoxanonacyclo[17.9.1.11,20.02,12.04,6.06,11.015,19.018,23.021,26]triacontane-10,16,25,30-tetrone | present | LOTUS |
05DNA & barcoding30 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Physalis angulata has left across the world's sequence archives.
At a glance
DNA specimens30
Marker genes6
GenBank sequences10
eDNA detections24
Countries7
The DNA barcodea real sequence read deposited for this species
GCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCT …
Physalis angulata isolate Sonso9 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Physalis angulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–502n range24median24mode42records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2423×CCDB · iber-fl · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +6
CCDB · iber-fl — Sur l'identification d'une espce de Physalis souspontane au Portugal. Fernandes, R.Bol. Soc. Brot. ser. 244: 343-366(1970).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3356
CCDB · ipcn-api-dl — Lydia, G. & K. G. R. Rao. 1981. Spontaneous desynapsis in tomatillo (Physalis ixocarpa Brot.). J. Cytol. Genet. 16: 197–201.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · ipcn-api-dl — Rao, K. G. R. & Y. L. Prasad. 1984. Pachytene chromosomes of Physalis lanceifolia Nees. Cytologia 49: 567–572.
CCDB · book-ipcn67-71 — FERNANDEZ, R.B. 1970. Sur !'identification d'une especie de Physalis souspontanee au Portugal. Bel. soc. Bret. 44 Cser. 2): 343-367.
CCDB · book-ipcn67-71 — MADHAVADIAN, P. 1968. Chromosome numbers in South Indian Solanaceae. Caryologia 21: 343-347.
CCDB · book-indian_vol1 — Menzel, M.Y. 1951; Sinha, N.P. 1951b; Gottschalk, W. 1954c; Fernandez, R.B. 1970; Rao, K.G.R. 1979
CCDB · book-indian_vol1 — Morton, J.K. 1964
CCDB · book-fedorov — Nakajima 1931
CCDB · book-fedorov — Gottschalk 1954c
CCDB · book-fedorov — Menzel 1951
CCDB · book-fedorov — Sinha N. P. 1951b
CCDB · book-fedorov — Morton J. K. 1964
CCDB · book-fedorov — I. 1964)
CCDB · book-fedorov — Menzel1951
CCDB · book-atlas-flowering-plants — Menzel 1951
CCDB · Automatic manuscript search — V. Bapat and G. Wenzel. 1982. "In vitro haploid plantlet induction in Physalis ixocarpa brot. through microspore embryogenesis". Plant Cell Reports 1:154-156.
GIFT · GIFT (floras)
2n 4818×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +3
CCDB · ipcn-api-dl — Ganapathi, A., S. Sudhakaran & S. Kulothungan. 1991. The diploid taxon in Indian natural populations of Physalis L. and its taxonomic significance. Cytologia 56: 283–288.
CCDB · ipcn-api-dl — Pedrosa, A. 1999. Citogenética de angiospermas coletadas em Pernambuco - V. Acta Bot. Brasil. 13(1): 49–60.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-indian_vol1 — Bhaduri, P.N. 1933 ; Gottschalk, W. 1954a; Baquar, S.R. et al. 1965; Baquar, S.R. 1967a ; Madhavadian, P. 1968 ; Gupta, S.K. & Roy, S.K. 1981
CCDB · book-fedorov — Yamamoto K., Sakai 1932
CCDB · book-fedorov — Tokunaga 1934
CCDB · book-fedorov — Baldwin, Spease 1951b
CCDB · book-fedorov — Menzel 1951
CCDB · book-fedorov — Morton J. K. 1964
CCDB · book-fedorov — I. 1964)
CCDB · book-fedorov — Bhaduri 1933
CCDB · book-fedorov — Gottschalk 1954a
CCDB · book-fedorov — Baquar et al. 1965
CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Bhaduri 1933
GIFT · GIFT (floras)
2n 501×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 2415×CCDB · iapt · CCDB · solan · CCDB · book-ipcn65 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iapt — IAPT/IOPB Chromosome Data 9
CCDB · solan
CCDB · book-ipcn65 — Baquar et al. 1965
CCDB · ipcn-api-dl — Lydia, G. & K. G. R. Rao. 1982. A new cytotype of Physalis angulata L. Chromosome Inf. Serv. 32: 3–4.
CCDB · ipcn-api-dl — Husaini, S. W. H. & G. A. Iwo. 1990. Cytomorphological studies in some weedy species of the family Solanaceae from Jos Plateau, Nigeria. Feddes Repert. 101: 41–47.
CCDB · ipcn-api-dl — VENKATESWARLU, J. & K. G. R. Rao. 1979a. Morphology of the pachytene chromosomes of Physalis angulata. Cytologia 44: 557–560.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978. Cytological studies in certain Bicarpellatae from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · ipcn-api-dl — Ganapathi, A., S. Sudhakaran & S. Kulothungan. 1991. The diploid taxon in Indian natural populations of Physalis L. and its taxonomic significance. Cytologia 56: 283–288.
CCDB · ipcn-api-dl — Bir, S. S., S. Kumari, S. P. Shoree & M. S. Sagoo. 1978a. Cytological studies in certain Bicarpeilatse from north and central India. J. Cytol. Genet. 13: 99–106.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967. Cytomorphological studies in the family Solanaceae from West Pakistan. Genetica 38: 388-397
CCDB · book-ipcn75-78 — Kaul et ;:il. 1976 b
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · Cave1956supp — Gottschalk 1954a
n 1212×CCDB · solan · CCDB · ipcn-api-dl · CCDB · Cave1956supp
CCDB · solan
CCDB · ipcn-api-dl — Rao, K. G. R. 1979. Morphology of the pachytene chromosomes of tomatillo (Physalis ixocarpa Brot.). Indian J. Bot. 2: 209–213.
CCDB · ipcn-api-dl — Quiros, C. F. 1984. Overview of the genetics and breeding of husk tomato. Hort. Sci. 19: 872–874.
CCDB · ipcn-api-dl — Rao, K. G. R. & Y. L. Prasad. 1984. Pachytene chromosomes of Physalis lanceifolia Nees. Cytologia 49: 567–572.
CCDB · Cave1956supp — Gottschalk 1954b
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~1.76 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin1.76 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type13 315 records
Wild obs. + sensor7 865
Museum / vouchered5 340
Cultivated / captive3
Other107
Origin
Native107
Introduced387
Range
Area of Occupancy AOO36 092 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 3 784≤1 km 851≤10 km 367>10 km 395
5 397 georeferenced · 2 468 without coordinates
Open the mapobservation + sensor7 865
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 359≤1 km 277≤10 km 495>10 km 116
1 247 georeferenced · 4 093 without coordinates
Open the institutions mapphysical evidence5 340
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 3 records without
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions187 of 377 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 354 |
| Brisbane, AU | 225 |
| Bronx, US | 216 |
| Beijing, CN | 188 |
| MeiseBGlocation not on record | 167 |
| Palmerston, AU | 136 |
| Wuzhou, CN | 101 |
| Nanjing, CN | 95 |
| Kew, GB | 91 |
| Pretoria, ZA | 83 |
| Paris, FR | 82 |
| Taipei, TW | 82 |
| University of Stellenboschlocation not on record | 78 |
| Guangzhou, CN | 72 |
| Jena Microbial Resource Collectionlocation not on record | 67 |
| Kensington, AU | 66 |
| Córdoba, AR | 63 |
| Puerto Ayora, EC | 55 |
| Chicago, US | 55 |
| Adelaide, AU | 54 |
| Tampa, US | 52 |
| Baroda, IN | 51 |
| South Kensington, GB | 50 |
| Taipei, TW | 49 |
| Smithfield, AU | 49 |
| National Museum of Natural Sciencelocation not on record | 46 |
| Austin, US | 46 |
| Museo Entomologico de Leonlocation not on record | 45 |
| Durango, MX | 42 |
| Kunming, CN | 37 |
| Juriquilla, MX | 37 |
| UNIVASFlocation not on record | 36 |
| Chengdu, CN | 35 |
| Xiamen, CN | 31 |
| Fort Worth, US | 30 |
| Universidad Nacional de Colombia (UNAL)location not on record | 30 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 30 |
| Laboratorio de Ictiologialocation not on record | 30 |
| TAIElocation not on record | 28 |
| ASUlocation not on record | 26 |
| Departamento de Sistematica e Ecologialocation not on record | 26 |
| LSF/FSA/UAClocation not on record | 26 |
| BAYLUlocation not on record | 24 |
| Wuhan, CN | 24 |
| JBRJlocation not on record | 24 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 24 |
| Canberra, AU | 24 |
| Sanda, JP | 24 |
| Bangkok, TH | 23 |
| Chaguaramas, TT | 23 |
| Jackson, US | 23 |
| Berlin, DE | 22 |
| Miami, US | 21 |
| Instituto do Meio Ambientelocation not on record | 21 |
| Frankfurt am Main | 21 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 20 |
| HNBlocation not on record | 20 |
| Mexico City, MX | 20 |
| Fayetteville, US | 20 |
| WAGlocation not on record | 20 |
| Porto Alegre, BR | 19 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 18 |
| UFMGlocation not on record | 17 |
| Chengdu, CN | 17 |
| Bloomington, US | 17 |
| Pittsburg, US | 17 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 17 |
| IBANNlocation not on record | 17 |
| Chapel Hill, US | 17 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 16 |
| Chongqing Museumlocation not on record | 16 |
| Honolulu, US | 16 |
| Taipei, TW | 16 |
| National Biodiversity Institute, Costa Ricalocation not on record | 16 |
| Tuscaloosa, US | 16 |
| San Isidro, AR | 16 |
| Leiden University Medical Centerlocation not on record | 15 |
| Santa Cruz de la Sierra, BO | 15 |
| Stockholm, SE | 15 |
| UFMSlocation not on record | 15 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 15 |
| Durham, US | 15 |
| Hunan Hupingshan National Nature Reservelocation not on record | 15 |
| Little Rock, US | 14 |
| Blumenau, BR | 14 |
| US | 14 |
| Paleontological Collectionlocation not on record | 14 |
| Herbier National du Gabonlocation not on record | 13 |
| Museu Paraense Emílio Goeldilocation not on record | 13 |
| Plocation not on record | 13 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 13 |
| Feira de Santana, BR | 13 |
| Universidade Federal do Maranhãolocation not on record | 13 |
| Yaoundé, CM | 12 |
| Brussel, BE | 12 |
| Anchorage, US | 12 |
| Corrientes, AR | 12 |
| Xinxiang, CN | 12 |
| UFBAlocation not on record | 11 |
| Aarhus, DK | 11 |
| UFERSAlocation not on record | 11 |
| Valdosta State Universitylocation not on record | 10 |
| UFRPElocation not on record | 10 |
| CEPLAClocation not on record | 9 |
| EL PASO, US | 9 |
| Guasave, MX | 9 |
| Seoul, KR | 9 |
| Universidad de Nariño (UdeNar)location not on record | 9 |
| Université du Lomélocation not on record | 9 |
| AUAlocation not on record | 9 |
| University of Southern Mississippilocation not on record | 9 |
| Cuiabá, BR | 9 |
| Auckland, NZ | 8 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 8 |
| Riverside, US | 8 |
| National Institute of Biological Resourceslocation not on record | 8 |
| MAlocation not on record | 8 |
| KURAlocation not on record | 8 |
| Kathmandu, NP | 8 |
| Masindi, UG | 8 |
| BISHlocation not on record | 8 |
| Guilin, CN | 7 |
| Nagatoro-machi, Chichibu-gun, JP | 7 |
| UnBlocation not on record | 7 |
| KR | 7 |
| Tuxtla Gutiérrez, MX | 7 |
| Altos de Pipe, VE | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| Durban, ZA | 7 |
| Universiti Sains Malaysialocation not on record | 7 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 7 |
| UFPElocation not on record | 7 |
| LBVlocation not on record | 7 |
| Cenargenlocation not on record | 7 |
| Elocation not on record | 7 |
| Mount Annan, AU | 7 |
| Dresden, DE | 7 |
| FUVATESlocation not on record | 7 |
| La Paz, MX | 7 |
| Armidale, AU | 7 |
| CNF-UFHBlocation not on record | 7 |
| La Paz, BO | 7 |
| Mérida, MX | 6 |
| Christchurch, NZ | 6 |
| BDBClocation not on record | 6 |
| Burlington, US | 6 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 6 |
| Tepatitlán de Morelos, MX | 6 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| Brasília, BR | 6 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 6 |
| Salvador, BR | 6 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 6 |
| León, NI | 5 |
| UNICAMPlocation not on record | 5 |
| James Cook Townsvillelocation not on record | 5 |
| Columbia, US | 5 |
| GAlocation not on record | 5 |
| Williamsburg, US | 5 |
| Brasília, BR | 5 |
| HUAlocation not on record | 5 |
| HUT Culture Collectionlocation not on record | 5 |
| Culiacán, MX | 5 |
| NSMKlocation not on record | 5 |
| IPA/SPlocation not on record | 5 |
| Texas Lutheran Universitylocation not on record | 4 |
| Flagstaff, US | 4 |
| Madison, US | 4 |
| Wlocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Campo Mourão, BR | 4 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 4 |
| National Museums of Kenyalocation not on record | 4 |
| Universidade Federal de Sergipe (UFS)location not on record | 4 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 4 |
| UEMAlocation not on record | 4 |
| UNITINSlocation not on record | 4 |
| UNESP-RClocation not on record | 4 |
| UTFPR-CPlocation not on record | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| Yunnan Universitylocation not on record | 4 |
| UESBlocation not on record | 4 |
| Edmonton, CA | 4 |
| LDlocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Tuxtla Gutiérrez, MX | 4 |
| CJBGlocation not on record | 4 |
| Kyoto Universitylocation not on record | 4 |
| UEPAlocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Knoxville, US | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Cruz das Almas, BR | 3 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 3 |
| BMlocation not on record | 3 |
| Pullman, US | 3 |
| Kagoshima, JP | 3 |
| UNESP-FCAlocation not on record | 3 |
| Guiyang, CN | 3 |
| Changsha, CN | 3 |
| BIO-UNIPIlocation not on record | 3 |
| Edinburgh, GB | 3 |
| Santarém, BR | 3 |
| Chapingo, MX | 3 |
| Tomioka, JP | 3 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 3 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 3 |
| CPATSAlocation not on record | 3 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 3 |
| USP-IBlocation not on record | 3 |
| San José, CR | 3 |
| Mississippi State, US | 3 |
| Jataí / Setor Industrial, BR | 3 |
| UFPIlocation not on record | 3 |
| Chiba, JP | 3 |
| University of Papua New Guinealocation not on record | 3 |
| Durham, US | 3 |
| MEXUlocation not on record | 3 |
| GB | 3 |
| Université National du Béninlocation not on record | 3 |
| Uppsala, SE | 3 |
| Lima, PE | 3 |
| BAlocation not on record | 3 |
| PUC-RSlocation not on record | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Stephenville, US | 3 |
| Zhengzhou, CN | 3 |
| Cusco, PE | 2 |
| Universidade Paulistalocation not on record | 2 |
| New Haven, US | 2 |
| LSFlocation not on record | 2 |
| Conway, US | 2 |
| The University of Arizonalocation not on record | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| Bando, JP | 2 |
| Clemson, US | 2 |
| Arequipa, PE | 2 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 2 |
| EAlocation not on record | 2 |
| Cape Town, ZA | 2 |
| UNESP-ISlocation not on record | 2 |
| Conway, US | 2 |
| Hobart, AU | 2 |
| Bern, CH | 2 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 2 |
| Universidad de Córdoba (UC)location not on record | 2 |
| Universidad Nacional del Litorallocation not on record | 2 |
| Zacatecas, MX | 2 |
| Toronto, CA | 2 |
| Iquitos, PE | 2 |
| Norfolk, US | 2 |
| National Natural History Collectionslocation not on record | 2 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 2 |
| Phoenix, US | 2 |
| LISClocation not on record | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Oulu, FI | 2 |
| Tapachula, MX | 2 |
| TNMlocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Logan, US | 2 |
| Lubbock, US | 2 |
| LGlocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Zhejiang Museum of Natural Historylocation not on record | 2 |
| HEMlocation not on record | 2 |
| San Angelo, US | 2 |
| Hangzhou, CN | 2 |
| Northridge, US | 2 |
| Pelotas, BR | 2 |
| Philadelphia, US | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Albuquerque, US | 2 |
| Tokushima, JP | 2 |
| UFSClocation not on record | 1 |
| Davis, US | 1 |
| Guangzhou, CN | 1 |
| Porto Velho, BR | 1 |
| Fortaleza, BR | 1 |
| Davenport, US | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Castelar, AR | 1 |
| Minia, EG | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Universidad del Tolima (UT)location not on record | 1 |
| Chicago, US | 1 |
| Centre National de Semences Forestièreslocation not on record | 1 |
| Russellville, US | 1 |
| Asheville, US | 1 |
| North-West University, A.P. Goossens Herbariumlocation not on record | 1 |
| Autlán de Navarro, MX | 1 |
| Denton, US | 1 |
| KNAMlocation not on record | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 1 |
| Vancouver, CA | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| HACAMlocation not on record | 1 |
| Barcelona, ES | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| OTSlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Görlitz, DE | 1 |
| Fairfax, US | 1 |
| IECOSlocation not on record | 1 |
| Loja, EC | 1 |
| Millersville, US | 1 |
| College Park, US | 1 |
| Pondicherry, IN | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Xining, CN | 1 |
| Criciúma, BR | 1 |
| Wuhan, CN | 1 |
| Capital Normal Universitylocation not on record | 1 |
| CASlocation not on record | 1 |
| Richmond, US | 1 |
| Brussels, BE | 1 |
| Cascavel, BR | 1 |
| Moscow, US | 1 |
| BRLUlocation not on record | 1 |
| Mlocation not on record | 1 |
| New Brunswick, US | 1 |
| LINUlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Institut Botanique Ake-Assi d'Andokoilocation not on record | 1 |
| Staten Island, US | 1 |
| Dublin, IE | 1 |
| UFPRlocation not on record | 1 |
| CMULlocation not on record | 1 |
| Fredericksburg, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| MEDELlocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Ulocation not on record | 1 |
| Mexico City, MX | 1 |
| Peking Universitylocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Knapp, S. (BM), 1993.location not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| UFOPlocation not on record | 1 |
| IFANlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Anton de Kom University of Surinamelocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Glocation not on record | 1 |
| Cochabamba, BO | 1 |
| WCSlocation not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| UNESClocation not on record | 1 |
| Guatemala, GT | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Philadelphia, US | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| CUVClocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Rishon Le Zion, IL | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| National Pingtung University of Science and Technologylocation not on record | 1 |
| Ilhéus, BR | 1 |
| Botanic Gardenlocation not on record | 1 |
| Dover, US | 1 |
| Awka, NG | 1 |
377 institutions · 5 021 of 5 340 vouchered records shown · 318 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA24 detections
Where the DNA of Physalis angulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found24
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 24 detections have coordinates
Open the map5 countries0
Garden.Sur les rivages de la riviere; echappe de cu…allotment
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.1 °C 18.2–27.0
Seasonal swing summer↔winter12.7 °C
Max temp (day)27.9 °C 22.6–30.3
Min temp (night)20.2 °C 13.2–23.6
Precipitation155 mm/mo 39.3–164
Air humidity63.8 % 56.5–66.0
Moisture balance-9.70 mm/mo -66.5–14.8
Vapour deficit1,018 Pa 877–1,286
Wind speed2.50 m/s 1.90–4.90
Cloud cover29.6 % 9.80–40.2
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.