Phymosia umbellata

(Cav.) Kearney · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Phymosia

At a glance

Occurrence records316

Data sources13

Biological traits8

DNA specimens5

eDNA detections2

Sources13 archives

Databases and archives Phymosia umbellata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility316 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF316 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT · NCBI≈139 Mbp

01Narrative

Phymosia umbellata is a species of flowering plant in the family Malvaceae. It is native to Mexico and is cultivated as an ornamental plant.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.25 mg

Seed mass max4.09 mg

Seed mass min4.09 mg

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climateseasonally dry tropical

Growth formtree

⚠ sources differ — GIFT: tree · TRY: shrub

Woodinesswoody

03Chemical composition1 compounds

Compounds documented for Phymosia umbellata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cadinane sesquiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Gossypol		present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phymosia umbellata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences6

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL537452.1 ↗350 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCACTAGGCCGAGGGCACGTCTGCATGGGTGTCACGCATC …

Phymosia umbellata voucher BRIT:Gostel552 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Phymosia umbellata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈138 977 964 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Phymosia umbellata0.14 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records34–342n range34median34mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 342×CCDB · ipcn-api-dl · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Fryxell, P. A. & D. M. Stelly. 1993. Documented chromosome numbers 1993: 2. Additional chromosome counts in the Malvaceae. Sida 15: 639–647.

CCDB · book-atlas-flowering-plants — Skovsted 1935

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type316 records

Wild obs. + sensor62

Museum / vouchered251

Other3

Origin

Introduced51

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 4≤1 km 52≤10 km 3

59 georeferenced · 3 without coordinates

Open the mapobservation + sensor62

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 174≤1 km 6≤10 km 14>10 km 1

195 georeferenced · 56 without coordinates

Open the institutions mapphysical evidence251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	97
Mexico City, MX	31
Mexico City, MX	29
Austin, US	26
Juriquilla, MX	14
Tlalnepantla, MX	5
Saint Louis, US	5
Barcelona, ES	5
BDBClocation not on record	4
University of Stellenboschlocation not on record	4
Auckland, NZ	3
Chapingo, MX	3
Ciudad de México, MX	3
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	2
San Francisco, US	2
Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record	2
Puebla, MX	1
Riverside, US	1
Chicago, US	1
Austin, US	1
Tuxtla Gutiérrez, MX	1
Bronx, US	1
Chongqing Museumlocation not on record	1
Tuxtla Gutiérrez, MX	1
BClocation not on record	1
Chicago, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
ASUlocation not on record	1
BISHlocation not on record	1
Fort Worth, US	1

30 institutions · 249 of 251 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Phymosia umbellata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.5 °C 28.5–28.5

Seasonal swing summer↔winter17.8 °C

Max temp (day)33.6 °C

Min temp (night)24.1 °C

Precipitation67.0 mm/mo

Air humidity59.5 %

Moisture balance-132 mm/mo

Vapour deficit1,579 Pa

Wind speed3.50 m/s

Cloud cover22.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)