Phymatotrichopsis omnivora

(Duggar) Hennebert · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Rhizinaceae/Phymatotrichopsis

At a glance

Occurrence records16

Data sources9

Biological traits0

DNA specimens32

eDNA detections32

Sources9 archives

Databases and archives Phymatotrichopsis omnivora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 2 countries32 detections

DNA & barcodingBOLD · NCBI32 specimens

Genome at a glanceGoaT · NCBI≈109 Mbp

01Narrative

Texas root rot (also known as Phymatotrichopsis root rot, Phymatotrichum root rot, cotton root rot, or, in the older literature, Ozonium root rot) is a disease that is fairly common in Mexico and the southwestern United States resulting in sudden wilt and death of affected plants, usually during the warmer months. It is caused by a soil-borne fungus named Phymatotrichopsis omnivora that attacks the roots of susceptible plants. It was first discovered in 1888 by Pammel and later named by Duggar in 1916. A monograph of this disease, which includes a historical review, was written by R.B. Streets and H.E. Bloss in 1973.R.B. Streets and H.E. Bloss. 1973. Phymatotrichum Root Rot. Monograph #8. The American Phytopathological Society, St. Paul, MN

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phymatotrichopsis omnivora has left across the world's sequence archives.

At a glance

DNA specimens32

Marker genes2

GenBank sequences10

eDNA detections32

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKJ410124.1 ↗475 bp

ACGT

ATAAACCTATCAGTGTACCTCTCCACGTTGCTTCCGTGTGGCCAGGGGCTTTGGCCAGCGATGCCGGCTCCGCGGGTTTCGCCCCCCATT …

Phymatotrichopsis omnivora isolate POD14 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Phymatotrichopsis omnivora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈109 036 701 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Phymatotrichopsis omnivora0.11 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness90.9% BUSCO

08Occurrence & distribution

Record type16 records

Wild obs. + sensor3

Museum / vouchered12

Other1

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	3
Bronx, US	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Baton Rouge, US	1

4 institutions · 6 of 12 vouchered records shown · 3 without an institution code

09Environmental DNA32 detections

Where the DNA of Phymatotrichopsis omnivora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 12.5–15.7

Seasonal swing summer↔winter9.60 °C

Max temp (day)22.0 °C 18.4–22.0

Min temp (night)9.00 °C 8.20–9.00

Precipitation34.7 mm/mo 34.7–79.6

Air humidity50.9 % 50.9–57.3

Moisture balance-93.3 mm/mo -93.3–-38.4

Vapour deficit884 Pa 733–884

Wind speed4.10 m/s 4.10–5.80

Cloud cover25.5 % 25.5–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)