Phymatopus behrensi

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Phymatopus

At a glance

Occurrence records18

Data sources5

Biological traits0

DNA specimens6

eDNA detections8

Sources5 archives

Databases and archives Phymatopus behrensi's data was compiled from.

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phymatopus behrensi has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

7Amostly conserved

16Tmostly conserved

217Gmostly conserved

271Cmostly conserved

475Amostly conserved

541Avariable

565Avariable

622Amostly conserved

628Gmostly conserved

AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAACAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.54%

Haplotypes4

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phymatopus californicussame genus3.3%Phymatopus hectoidessame genus4.7%Oxycanus antipodasame family6.2%Zenophassus schamylsame family6.5%Jeana delicatulasame family6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type18 records

Museum / vouchered18

Range

Area of Occupancy AOO20 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 2

5 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence18

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	12
East Lansing, US	2
New Haven, US	1
San Diego, US	1
Essig Museum of Entomologylocation not on record	1

5 institutions · 17 of 18 vouchered records shown · 1 without an institution code

09Environmental DNA8 detections

Where the DNA of Phymatopus behrensi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

Clearing

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 13.3–15.4

Seasonal swing summer↔winter5.80 °C

Max temp (day)18.0 °C 18.0–21.2

Min temp (night)11.0 °C 8.40–11.4

Precipitation5.60 mm/mo 5.60–24.0

Air humidity67.0 % 53.4–67.0

Moisture balance-145 mm/mo -159–-124

Vapour deficit529 Pa 529–785

Wind speed1.30 m/s 1.30–4.00

Cloud cover37.4 % 36.5–39.1

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)