Phyllota phylicoides

(Sieber ex DC.) Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Phyllota

At a glance

Occurrence records3 667

Data sources10

Biological traits38

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Phyllota phylicoides's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 667 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources38 traits

Occurrence & distributionGBIF3 667 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB914 Mbp

01Narrative

Phyllota phylicoides is a species of flowering plant in the pea family (Fabaceae) found in New South Wales and Queensland. It was first described by George Bentham in 1837.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Leaf length10.5 mm

Leaf length max15 mm

Leaf length min6 mm

Leaf mass1.48 mg

Leaf mass per area137 g/m2

Leaf size11.59 mm²

Leaf width1.2 mm

Leaf width max1.25 mm

Plant height1 m

⚠ sources differ — AusTraits: 1 m · TRY: 0.73 m

Plant height max1 m

Seed mass2.81 mg

⚠ sources differ — TRY: 2.81 mg · AusTraits: 2.63 mg · GIFT: 2.79 mg

Seed mass max3.03 mg

Seed mass min2.6 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typeanimal

Flowering timennnnnnnnyyyn

Life spanperennial

Lifespan years30 years

Reproductive maturity4 years

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typelegume

Growth formshrub

Leaf compoundnesssimple

Leaf shapestrap-shaped

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry4

Leaf n12.78 mg/g

Leaf p0.18 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)6.38 mm²/mg

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllota phylicoides has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF113767.1 ↗658 bp

ACGT

ATTGTCGATGCCTCACAAGCAGTGCGACCCGTGAATTTGTTTTTCTACCGAGGGCAGGCCCGGGGGTGCTCGACACCTCTGACCTCCCTT …

Phyllota phylicoides internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Phyllota phylicoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size914 430 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Phyllota phylicoides0.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

n 72×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — SANDS, V. E. 1975. The cytoevolution of the Australian Papilionaceae. Proc. Linn. Soc. New South Wales 100: 118–155.

CCDB · book-ipcn75-78 — Sands 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=0.968 ↗

08Occurrence & distribution

Record type3 667 records

Wild obs. + sensor2 646

Museum / vouchered846

Cultivated / captive11

Other164

Origin

Native248

Range

Area of Occupancy AOO6 044 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 1 897≤1 km 389≤10 km 133>10 km 34

2 453 georeferenced · 193 without coordinates

Open the mapobservation + sensor2 646

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 130≤1 km 163≤10 km 334>10 km 112

739 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence846

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 10≤1 km 1

11 georeferenced

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	248
Canberra, AU	182
Brisbane, AU	160
Museo Entomologico de Leonlocation not on record	89
Armidale, AU	58
Adelaide, AU	27
Wollongong, AU	23
NSW Dept of Planning, Industry and Environmentlocation not on record	11
Kensington, AU	9
John T. Waterhouse Herbariumlocation not on record	6
Batemans Bay, AU	6
Hobart, AU	5
Kew, GB	4
LDlocation not on record	4
Smithfield, AU	3
Pretoria, ZA	2
Auckland, NZ	2
EL PASO, US	1
La Trobe Universitylocation not on record	1

19 institutions · 841 of 846 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Phyllota phylicoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 22.4–22.4

Seasonal swing summer↔winter8.90 °C

Max temp (day)25.4 °C

Min temp (night)19.6 °C

Precipitation134 mm/mo

Air humidity59.7 %

Moisture balance-27.6 mm/mo

Vapour deficit1,082 Pa

Wind speed2.60 m/s

Cloud cover21.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyllota phylicoides

At a glance

Sources10 archives

Size & morphology13

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 667 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 667 records