Phyllostachys rubromarginata

McClure · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Phyllostachys

At a glance

Occurrence records73

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Phyllostachys rubromarginata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility73 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF73 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 48

01Narrative

Phyllostachys rubromarginata, the reddish bamboo or red margin bamboo, is a species of Phyllostachys bamboo, native to Central China, specifically Guangxi and Guizhou.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height8 m

Life cycle & reproduction2

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Graminoid, Shrub

Woodinessnon-woody

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllostachys rubromarginata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLMK982136.1 ↗530 bp

ACGT

GAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAGGATTATAAATTGACTTATTACACCCCGGAGTATGAAACCAAGGATACTGAT …

Phyllostachys rubromarginata voucher TARS 16459 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllostachys rubromarginata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Li, X. l., S. Liu, W. q. Song, R. y. Chen & Y. z. Wang. 1999. Chromosome number of forty species of scattered bamboos. Acta Phytotax. Sin. 37(6): 541–544.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type73 records

Museum / vouchered73

Range

Area of Occupancy AOO76 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤1 km 5≤10 km 1

6 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence73

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nanjing, CN	26
nlocation not on record	17
Central China Normal Universitylocation not on record	10
Beijing, CN	6
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	5
Bronx, US	2
Hangzhou, CN	2
Zhengzhou, CN	2
Guilin, CN	1
Chongqing Museumlocation not on record	1
Saint Louis, US	1

11 institutions · 73 of 73 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)