Phyllostachys kwangsiensis

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Phyllostachys

At a glance

Occurrence records21

Data sources8

Biological traits7

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Phyllostachys kwangsiensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility21 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF21 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 48

01Narrative

Phyllostachys kwangsiensis is a species of bamboo found in Guangxi, China

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height16 m

Life cycle & reproduction1

Life formbamboo

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllostachys kwangsiensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSMH428867.1 ↗697 bp

ACGT

AGAAGTCGTAACAAGGTTTCCGTAGGGGAACCTGCGGAAGGATCATTGTCGTGACCCTAACCAAAACAGACCGCGCACGCGTCACCCATG …

Phyllostachys kwangsiensis small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllostachys kwangsiensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 481×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Chen, R. y. & W. x. Zong. 1991. Chromosome numbers of some scattered bamboos. Acta Phytotax. Sin. 29(5): 452–455.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type21 records

Museum / vouchered21

Range

Area of Occupancy AOO24 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

10Collections & institutions

Holding institutions4 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Nanjing, CN	7
nlocation not on record	7
Changsha, CN	4
Beijing, CN	2
Guilin, CN	1

5 institutions · 21 of 21 vouchered records shown