Phyllostachys glauca

McClure · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Phyllostachys

At a glance

Occurrence records253

Data sources10

Biological traits11

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Phyllostachys glauca's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility253 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF253 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2.2 Gbp

01Narrative

Phyllostachys glauca is a species of bamboo found in Anhui, Henan, Hunan, Jiangsu, Shaanxi, Shandong, Shanxi, Yunnan, Zhejiang provinces of China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height15 m

Life cycle & reproduction3

DeciduousnessEvergreen broad-leaved

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllostachys glauca has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences8

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP711062.1 ↗599 bpChina

ACGT

TCGTGACCCTAACCAAAACAGACCGCGCACGCGTCACCCATGCCGCCGGGCGGCAGCCGTCGCCCGGCCCAGGCCCGGCCTCCCGCAAGG …

Phyllostachys glauca internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllostachys glauca carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 224 950 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Phyllostachys glauca2.22 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome records48–482n range48median48mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 483×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Chen, R. y. & W. x. Zong. 1991. Chromosome numbers of some scattered bamboos. Acta Phytotax. Sin. 29(5): 452–455.

CCDB · ipcn-api-dl — Chen, R. y., X. l. Li, W. q. Song, G. l. Liang, P. x. Zhang, R. s. Lin, W. x. Zong, C. b. Chen & H. l. Fung. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 4, Chromosome Atlas of Various Bamboo Species. Science Press, Beijing.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type253 records

Wild obs. + sensor1

Museum / vouchered252

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 252 records without

Open the institutions mapphysical evidence252

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zhengzhou, CN	111
nlocation not on record	87
Nanjing, CN	26
Hangzhou, CN	7
Xian, CN	7
Beijing, CN	5
Changsha, CN	5
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	1
FJIDClocation not on record	1
Xian, CN	1
Yunnan Universitylocation not on record	1

11 institutions · 252 of 252 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Phyllostachys glauca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)