Phyllostachys edulis

(Carrière) J.Houz. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Phyllostachys

At a glance

Occurrence records440

Data sources13

Biological traits14

DNA specimens15

eDNA detections11

Sources13 archives

Databases and archives Phyllostachys edulis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility440 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionFooDB · LOTUS · NPASS5 644 compounds

Occurrence & distributionGBIF440 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD · NCBI15 specimens

Genome at a glanceCCDB · GoaT · NCBI2.3 Gbp

01Narrative

Phyllostachys edulis, le bambou Moso ou bambou d'hiver, est une espèce de bambou de la sous-famille des Bambusoideae, de la famille des Poaceae, originaire de Chine. De toutes les espèces de bambou, le bambou moso est celui qui a la plus grande importance économique en Chine. C'est l'espèce susceptible d'atteindre le plus grand développement en France, en particulier dans le sud du pays. Sa taille est de 15 à 20 mètres, voire plus. Les tiges tendres des jeunes pousses ont été utilisées à partir du VIe siècle pour fabriquer du papier de bambou traditionnel en Chine. Parmi les papiers traditionnels, ces papiers de bambou sont devenus dominants dans la Chine du Sud, là où la matière première est abondante. Depuis les années 1930, il est aussi utilisé par les machines à papier de l’industrie papetière. Les pousses de bambou Moso sont comestibles. Ses jeunes pousses sont cultivées pour la consommation.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height20 m

Plant height max15 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTÁrea Antrópica

Woodinesswoody

Physiology & chemistry1

Leaf p1.3 mg/g

03Chemical composition5 644 compounds

Compounds documented for Phyllostachys edulis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingVegetables

Compound class profile5 classes

Aminoacids107

Glycerophospholipids57

Cinnamic acids and derivatives46

Pyridine alkaloids31

Monosaccharides28

Documented compounds5 644 total

Tissue Source Quantified only

Compound	Amount	Source
Sugars	3,000 mg/100g	FooDB
Sodium	600 mg/100 g	FooDB
Nitrogen	600 mg/100 g	FooDB
Potassium	533 mg/100g	FooDB
L-Aspartic acid	425 mg/100g	FooDB

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllostachys edulis has left across the world's sequence archives.

At a glance

DNA specimens15

Marker genes4

GenBank sequences10

eDNA detections11

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPX279225.1 ↗704 bpKorea · 2022

ACGT

CCCCGACGTCGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGAT …

Phyllostachys edulis isolate Leaf small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL9★rbcLa★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Phyllostachys edulis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 273 850 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Phyllostachys edulis2.27 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome records48–482n range48median48mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 4810×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Huang, S. f., Y. q. Wang, Y. p. Lou & J. h. Xiao. 1988. A report on chromosome numbers in Bambusoideae. Forest Res. (China) 1: 109–111.

CCDB · ipcn-api-dl — Chen, R. y. & W. x. Zong. 1991. Chromosome numbers of some scattered bamboos. Acta Phytotax. Sin. 29(5): 452–455.

CCDB · ipcn-api-dl — Chen, R. y., X. l. Li, W. q. Song, G. l. Liang, P. x. Zhang, R. s. Lin, W. x. Zong, C. b. Chen & H. l. Fung. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 4, Chromosome Atlas of Various Bamboo Species. Science Press, Beijing.

CCDB · ipcn-api-dl — Li, X. l., S. Liu, W. q. Song, R. y. Chen & Y. z. Wang. 1999. Chromosome number of forty species of scattered bamboos. Acta Phytotax. Sin. 37(6): 541–544.

CCDB · book-ipcn67-71 — KONDO, s. 1965. Karyotype analysis on Bambusaceae (3). Rep. Fuji Bamboo Gard. 10: 81-85.

CCDB · eflora

CCDB · book-fedorov — Uchikawa 1933

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.9% BUSCO

08Occurrence & distribution

Record type440 records

Wild obs. + sensor347

Museum / vouchered89

Cultivated / captive4

Origin

Introduced1

Range

Area of Occupancy AOO1 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 110≤1 km 28≤10 km 76>10 km 62

276 georeferenced · 71 without coordinates

Open the mapobservation + sensor347

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 1≤1 km 15≤10 km 9>10 km 1

26 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence89

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 2 without coordinates

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kochi, JP	18
Toyama, JP	10
Guiyang, CN	10
Beijing, CN	8
BIO-UNIPIlocation not on record	8
Shinshu Universitylocation not on record	7
Guangzhou, CN	3
Sendai, JP	2
Nanjing, CN	2
Sagamihara, JP	2
Zhejiang Museum of Natural Historylocation not on record	2
KR	2
Fukushima Universitylocation not on record	2
Wellington, NZ	1
Ivano-Frankivsk, UA	1
Karlsruhe Institute of Technology, Botanical Gardenlocation not on record	1
Taipei, TW	1
Bloomington, US	1
Lanzhou, CN	1
Shanghai, CN	1
IPA/SPlocation not on record	1
J.F.Oberlin Universitylocation not on record	1
Denver, US	1
Tokushima, JP	1
Istituto Agrario Castelnuovolocation not on record	1
Chongqing Museumlocation not on record	1

26 institutions · 89 of 89 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA11 detections

Where the DNA of Phyllostachys edulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C

Min temp (night)4.60 °C

Precipitation58.1 mm/mo

Air humidity64.0 %

Moisture balance-4.10 mm/mo

Vapour deficit449 Pa

Wind speed3.70 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyllostachys edulis

At a glance

Sources13 archives

Size & morphology2

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

Compound class profile5 classes

Documented compounds5 644 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type440 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 26 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Documented compounds5 644 total