Phyllostachys bissetii — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Phyllostachys

At a glance

Occurrence records22

Data sources6

Biological traits12

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Phyllostachys bissetii's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility22 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF22 records

DNA & barcodingNCBIsequences

01Narrative

Phyllostachys bissetii is a species of bamboo found in Sichuan, Zhejiang provinces of China and introduced elsewhere. It is among the most cold-hardy bamboos. Its culms are relatively thin for its height in comparison to other running bamboo species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height6 m

Life cycle & reproduction2

Deciduousnessdeciduous

Life formbamboo

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: non-woody

Physiology & chemistry2

Leaf n26.3 mg/g

Leaf p1.04 mg/g

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllostachys bissetii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH428865.1 ↗687 bp

ACGT

CAAGGTTTCCGTAGGGGAACCTGCGGAAGGATCATTGTCGTGACCCTAACCAAAACAGACCGCGCACGCGTCACCCATGCCGCCGGGCGG …

Phyllostachys bissetii small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL3ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type22 records

Wild obs. + sensor4

Museum / vouchered18

Range

Area of Occupancy AOO60 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2≤1 km 2

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence18

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	5
Chengdu, CN	4
Hangzhou, CN	2
Changsha, CN	2
Bronx, US	1
Denver, US	1
Christchurch, NZ	1
Auckland, NZ	1

8 institutions · 17 of 18 vouchered records shown · 1 without an institution code