Phyllostachys aureosulcata

McClure · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Phyllostachys

At a glance

Occurrence records649

Data sources10

Biological traits9

DNA specimens3

eDNA detections1

Sources10 archives

Databases and archives Phyllostachys aureosulcata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility649 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF649 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 48

01Narrative

Phyllostachys aureosulcata, the yellow groove bamboo, is a species of bamboo native to the Zhejiang Province of China. It is a running bamboo with a distinctive yellow stripe in the culm groove (or sulcus) that is often grown as an ornamental.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height9 m

Life cycle & reproduction2

Life formbamboo

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Shrub, Graminoid

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllostachys aureosulcata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences9

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKX146453.1 ↗553 bpGermany

ACGT

AAGTGTTGGATTTAAAGCTGGTGTTAAGGATTATAAATTGACTTATTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGC …

Phyllostachys aureosulcata ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL7★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllostachys aureosulcata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 48 n = 24

Ploidydiploid inferred

Chromosome records48–482n range48median48mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 483×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Li, X. l., S. Liu, W. q. Song, R. y. Chen & Y. z. Wang. 1999. Chromosome number of forty species of scattered bamboos. Acta Phytotax. Sin. 37(6): 541–544.

CCDB · ipcn-api-dl — Chen, R. y. & W. x. Zong. 1991. Chromosome numbers of some scattered bamboos. Acta Phytotax. Sin. 29(5): 452–455.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type649 records

Wild obs. + sensor535

Museum / vouchered108

Cultivated / captive5

Other1

Range

Area of Occupancy AOO1 688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 377≤1 km 39≤10 km 21>10 km 20

457 georeferenced · 78 without coordinates

Open the mapobservation + sensor535

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 26≤1 km 6≤10 km 2>10 km 1

35 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence108

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
nlocation not on record	29
LDlocation not on record	10
SLU Artdatabankenlocation not on record	10
Millersville, US	8
Saint Louis, US	7
Beijing, CN	6
Salzburg, AT	5
Knoxville, US	5
McWane Science Centerlocation not on record	4
Christchurch, NZ	3
Tuscaloosa, US	2
EL PASO, US	1
Ann Arbor, US	1
Corvallis, US	1
Auckland, NZ	1
GAlocation not on record	1
Chongqing Museumlocation not on record	1
Williamsburg, US	1
Fairfax, US	1
Dover, US	1
University of Southern Mississippilocation not on record	1
Zhengzhou, CN	1
Logan, US	1
University of Tennessee at Chattanoogalocation not on record	1
Vancouver, CA	1
Jackson, US	1
Karlsruhe Institute of Technology, Botanical Gardenlocation not on record	1

27 institutions · 105 of 108 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Phyllostachys aureosulcata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter17.7 °C

Max temp (day)11.9 °C

Min temp (night)4.60 °C

Precipitation58.1 mm/mo

Air humidity64.0 %

Moisture balance-4.10 mm/mo

Vapour deficit449 Pa

Wind speed3.70 m/s

Cloud cover41.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)