Phyllostachys aurea
(André) Rivière & C.Rivière · speciesAt a glance
Occurrence records2 944
Data sources11
Biological traits99
DNA specimens8
eDNA detections7
Sources11 archives
Databases and archives Phyllostachys aurea's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 944 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources99 traits
Occurrence & distributionGBIF2 944 records
Environmental DNA1 datasets · 1 countries7 detections
DNA & barcodingBOLD · NCBI8 specimens
Genome at a glanceCCDB2n = 48
01Narrative
Phyllostachys aurea is a species of bamboo, and is of the 'running bamboo' type, belonging to the diverse Bambuseae tribe. It is native to Fujian and Zhejiang in China. It is commonly known by the names fishpole bamboo, golden bamboo, monk's belly bamboo, and fairyland bamboo (Australia).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology11
Fruit width1.75 mm
Fruit width max2 mm
Fruit width min1.5 mm
Leaf length100 mm
Leaf length max90 mm
Leaf width14 mm
⚠ sources differ — AusTraits: 14 mm · GIFT: 13 mm
Leaf width max13 mm
Leaf width min13 mm
Plant height4.55 m
⚠ sources differ — GIFT: 4.55 m · AusTraits: 6 m · USDA: 4.57 m · TRY: 6.5 m
Plant height max6 m
Plant height min2 m
Life cycle & reproduction23
Coppice potentialNo
Deciduousnessdeciduous
Flower conspicuousNo
Growth rate USDARapid
Life formbamboo
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualpresent
Resprout abilityYes
Resprouting capacityresprouts
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment28
Active growth periodSpring, Summer, Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 500 m
Elevation min800 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureCoarse
Fruit typecaryopsis
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: graminoid herb · TRY: Herb
Growth form USDARhizomatous
Habitat GIFTÁrea Antrópica
Hedge toleranceHigh
Known allelopathNo
Leaf retentionYes
Leaf shapelanceolate narrowly_lanceolate oblong
Low growing grassNo
Root depth min14 in
Shape and orientationErect
Small grainNo
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: woody
Physiology & chemistry19
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min180 days
Moisture useLow
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min35 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min5 pH
Temperature min-3 °F
Uses & economy12
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits5
Fall conspicuousYes
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max700 per acre
Planting density min300 per acre
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllostachys aurea has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes3
GenBank sequences10
eDNA detections7
Countries2
The DNA barcodea real sequence read deposited for this species
GTGACCCTAACCAAAAAGACCCGCACGCGTCCCAGCCGCCGGGCGGCAGCCGCCGCTCGGCCTAGGCCCGGCCTCCCGCGAGGGAGGGCG …
Phyllostachys aurea voucher LEB<ESP>:C.Acedo 234.2011 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Phyllostachys aurea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidydiploid inferred
Chromosome records48–482n range48median48mode6records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 486×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-fedorov +1
CCDB · ipcn-api-dl — Pohl, R. W. & G. Davidse. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23(3): 293–324.
CCDB · ipcn-api-dl — Chen, R. y. & W. x. Zong. 1991. Chromosome numbers of some scattered bamboos. Acta Phytotax. Sin. 29(5): 452–455.
CCDB · ipcn-api-dl — Fang, W., J. r. Wu & Y. c. Sheng. 1991. Chromosome number of ten species of scattered bamboos. J. Zhejiang Forest. Coll. 8(1): 127–130.
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-fedorov — Uchikawa 1935
CCDB · book-atlas-flowering-plants — Uchikawa 1935
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type2 944 records
Wild obs. + sensor2 068
Museum / vouchered811
Cultivated / captive5
Other60
Origin
Native19
Introduced205
Range
Area of Occupancy AOO8 160 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy95% within 1 km
≤100 m 1 359≤1 km 194≤10 km 48>10 km 29
1 630 georeferenced · 438 without coordinates
Open the mapobservation + sensor2 068
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy63% within 1 km
≤100 m 84≤1 km 76≤10 km 61>10 km 31
252 georeferenced · 559 without coordinates
Open the institutions mapphysical evidence811
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 4 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions99 of 163 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Christchurch, NZ | 64 |
| BAYLUlocation not on record | 58 |
| Nagano City, JP | 33 |
| Jena Microbial Resource Collectionlocation not on record | 24 |
| BIO-UNIPIlocation not on record | 24 |
| KURAlocation not on record | 21 |
| Odawara, JP | 17 |
| Auckland, NZ | 17 |
| Saint Louis, US | 16 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 13 |
| Museo Entomologico de Leonlocation not on record | 13 |
| Kochi, JP | 13 |
| Mount Annan, AU | 12 |
| University of Stellenboschlocation not on record | 12 |
| Columbia, US | 11 |
| Université de Bordeauxlocation not on record | 11 |
| Sanda, JP | 11 |
| Brisbane, AU | 10 |
| Corvallis, US | 10 |
| nlocation not on record | 9 |
| Central China Normal Universitylocation not on record | 9 |
| Fort Worth, US | 9 |
| Jackson, US | 9 |
| Canberra, AU | 9 |
| BDBClocation not on record | 9 |
| Beijing, CN | 8 |
| Austin, US | 8 |
| Rotorua, NZ | 8 |
| Nishihara, JP | 8 |
| Brasília, BR | 7 |
| BISHlocation not on record | 7 |
| Tampa, US | 7 |
| Nishihara, JP | 6 |
| Zhengzhou, CN | 6 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 6 |
| Bronx, US | 5 |
| Vancouver, CA | 5 |
| Armidale, AU | 5 |
| Sagamihara, JP | 5 |
| Tuscaloosa, US | 5 |
| Kew, GB | 5 |
| Durango, MX | 5 |
| Fairfax, US | 5 |
| Davis, US | 5 |
| Williamsburg, US | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| San Angelo, US | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| UnBlocation not on record | 5 |
| UTFPR-CPlocation not on record | 4 |
| Valdosta State Universitylocation not on record | 4 |
| Campo Mourão, BR | 4 |
| Wuzhou, CN | 4 |
| Changsha, CN | 4 |
| València, ES | 4 |
| Bando, JP | 4 |
| Mexico City, MX | 4 |
| Sendai, JP | 4 |
| UNESClocation not on record | 4 |
| Southwest Forestry Collegelocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Barcelona, ES | 3 |
| Riverside, US | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| Nanjing, CN | 3 |
| Badajoz, ES | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| WTUlocation not on record | 3 |
| Tsukuba, JP | 3 |
| Logan, US | 3 |
| Claremont, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Clemson, US | 3 |
| Hobart, AU | 3 |
| Batemans Bay, AU | 3 |
| Santa Barbara, US | 3 |
| Mississippi State, US | 3 |
| Henderson State Universitylocation not on record | 3 |
| Kawasaki Shi Tama Ku, JP | 3 |
| San Luis Obispo, US | 3 |
| BClocation not on record | 3 |
| San Diego, US | 3 |
| AUAlocation not on record | 3 |
| Bangkok, TH | 2 |
| Forest Herbarium Ibadan (FHI)location not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Córdoba, AR | 2 |
| Vitoria, ES | 2 |
| Knoxville, US | 2 |
| ASUlocation not on record | 2 |
| Millersville, US | 2 |
| JBRJlocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Miami, US | 2 |
| College Park, US | 2 |
| Adelaide, AU | 2 |
| Fayetteville, US | 2 |
| ISAlocation not on record | 2 |
| GAlocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Fukushima Universitylocation not on record | 2 |
| Chapel Hill, US | 2 |
| Guilin, CN | 2 |
| TLAXlocation not on record | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 2 |
| Guangzhou, CN | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| UFSClocation not on record | 2 |
| Criciúma, BR | 2 |
| Chadron, US | 1 |
| Gifu prefectural Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| Puerto Ayora, EC | 1 |
| Chicago, US | 1 |
| La Paz, BO | 1 |
| Plocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Xiamen, CN | 1 |
| Montecillo, Texcoco, MX | 1 |
| Little Rock, US | 1 |
| Johnson City, US | 1 |
| Chapingo, MX | 1 |
| Kensington, AU | 1 |
| Xian, CN | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Minia, EG | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Washington, US | 1 |
| New Brunswick, US | 1 |
| Chiba, JP | 1 |
| Flagstaff, US | 1 |
| Norfolk, US | 1 |
| San Isidro, AR | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| EL PASO, US | 1 |
| Berlin, DE | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| USP-IBlocation not on record | 1 |
| San José, CR | 1 |
| Brasília, BR | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Hiratsuka City Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| Arcata, US | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Cenargenlocation not on record | 1 |
| Bloomington, US | 1 |
| Shenzhen, CN | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Chaguaramas, TT | 1 |
| MAlocation not on record | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Northridge, US | 1 |
163 institutions · 806 of 811 vouchered records shown · 5 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Phyllostachys aurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.7 °C 15.7–15.7
Seasonal swing summer↔winter14.2 °C
Max temp (day)19.7 °C
Min temp (night)12.8 °C
Precipitation104 mm/mo
Air humidity62.4 %
Moisture balance19.5 mm/mo
Vapour deficit666 Pa
Wind speed2.60 m/s
Cloud cover37.8 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.