Phyllopteryx taeniolatus

(Lacepède, 1804) · species

image placeholder — illustration coming later

Animalia/Chordata/Syngnathiformes/Syngnathidae/Phyllopteryx

At a glance

Occurrence records5 061

Data sources12

Biological traits6

DNA specimens140

eDNA detections139

Sources12 archives

Databases and archives Phyllopteryx taeniolatus's data was compiled from.

WikipediaWikimedia Foundation15 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 261 records↗

OBISOcean Biodiversity Information System800 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI139 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics140 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS5 061 records

Environmental DNA1 datasets · 1 countries139 detections

DNA & barcodingBOLD140 specimens

Genome at a glanceGoaT · NCBI≈668 Mbp

01Narrative

The common seadragon or weedy seadragon (Phyllopteryx taeniolatus) is a marine fish related to the seahorses. Adult common seadragons are a reddish colour, with yellow and purple markings; they have small leaf-like appendages that resemble kelp fronds providing camouflage and a number of short spines for protection.Bray, D.J. 2011, Common Seadragon, Phyllopteryx taeniolatus, in Fishes of Australia, accessed 26 Aug 2014, http://www.fishesofaustralia.net.au/home/species/3127 Males have narrower bodies and are darker than females. Seadragons have a long dorsal fin along the back and small pectoral fins on either side of the neck, which provide balance. Common seadragons can reach 45 cm in length. The common seadragon is the marine emblem of the Australian state of Victoria.Dept of Sustainability and Environment Victoria > The marine faunal emblem for the State of Victoria Retrieved 8 August 2011

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length46 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Other traits3

Depth max50 m

Depth min0 m

Vulnerability24.28

05DNA & barcoding140 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllopteryx taeniolatus has left across the world's sequence archives.

At a glance

DNA specimens140

BINs1

Marker genes1

eDNA detections139

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P664 bp consensus139 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

72Gmostly conserved

195Tmostly conserved

208Cmostly conserved

318Tvariable

327Tmostly conserved

330Amostly conserved

456Tmostly conserved

573Tmostly conserved

606Amostly conserved

615Cmostly conserved

630Amostly conserved

633Tmostly conserved

GGCACCCTATATTTAGTATTTGGTGCATGAGCCGGAATGGTGGGTACCGCACTAAGCCTACTCATCCGGGCGGAACTAAGCCAACCCGGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.71%

Haplotypes17

BIN1

Most divergent pair2.3%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phycodurus equessame family10.8%Solegnathus lettiensissame family13.2%Solegnathus hardwickiisame family15.5%Solegnathus spinosissimussame family16.0%Trachyrhamphus serratussame family16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_065496 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBrrn12rrn16

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Phyllopteryx taeniolatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈668 103 038 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Phyllopteryx taeniolatus0.67 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~19.7 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin19.7 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type5 061 records

Wild obs. + sensor3 272

Museum / vouchered1 789

Origin

Native1

Range

Area of Occupancy AOO4 824 km²

Depth

0–200 m sunlit54

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 78 m · 54 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 322≤1 km 514≤10 km 62>10 km 898

2 796 georeferenced · 476 without coordinates

Open the mapobservation + sensor3 272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 15≤1 km 194≤10 km 348>10 km 181

738 georeferenced · 1 051 without coordinates

Open the institutions mapphysical evidence1 789

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	149
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	84
Western Australian Museumlocation not on record	82
Museums Victorialocation not on record	43
Tasmanian Museum & Art Gallerylocation not on record	18
Australian National Fish Collectionlocation not on record	16
QVMAGlocation not on record	7
	6
Natick, US	5
Paris, FR	4
Frankfurt am Main	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
UWFClocation not on record	1
Vancouver, CA	1
CASlocation not on record	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
McGill University, Redpath Museumlocation not on record	1
University of California San Diegolocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1

19 institutions · 426 of 1 789 vouchered records shown · 490 without an institution code

09Environmental DNA139 detections

Where the DNA of Phyllopteryx taeniolatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found139

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 139 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 14.2–19.4

Seasonal swing summer↔winter7.70 °C

Max temp (day)19.0 °C 17.1–22.1

Min temp (night)15.2 °C 10.1–18.0

Precipitation59.9 mm/mo 20.4–125

Air humidity59.0 % 56.8–60.3

Moisture balance-10.2 mm/mo

Vapour deficit773 Pa 692–906

Wind speed4.60 m/s

Cloud cover21.4 % 14.3–24.7

CHELSA 1981–2010, ~9 km grid, at location & month of 135 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyllopteryx taeniolatus

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type5 061 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 061 records