Phylloporus pelletieri

(Lév.) Quél. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Phylloporus

At a glance

Occurrence records1 311

Data sources11

Biological traits0

DNA specimens2

eDNA detections4

Sources11 archives

Databases and archives Phylloporus pelletieri's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 311 records

Environmental DNA2 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈32 Mbp

01Narrative

Phylloporus pelletieri, commonly known as the golden-gilled bolete, is a species of fungus in the family Boletaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phylloporus pelletieri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences4

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSJQ967258.1 ↗672 bpUnited Kingdom

ACGT

CTGTCGCTGGCAGTCGACTGACTGCATGTGACACGTCCTTCTCTCTCTCTATCACACCTGTGCACCTTTTGTAGATCCACCTCGAAAAGA …

Phylloporus pelletieri voucher K 128205 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Phylloporus pelletieri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈32 394 983 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Phylloporus pelletieri0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 311 records

Wild obs. + sensor1 088

Museum / vouchered219

Other4

Origin

Native2

Range

Area of Occupancy AOO3 056 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 140≤1 km 199≤10 km 555>10 km 15

909 georeferenced · 179 without coordinates

Open the mapobservation + sensor1 088

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 9≤1 km 53≤10 km 52

114 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence219

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
GJOlocation not on record	34
Kew, GB	31
Görlitz, DE	23
LDlocation not on record	21
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	15
WU-MYClocation not on record	14
Karlsruhe, DE	13
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	11
SLU Artdatabankenlocation not on record	8
Zürich, CH	3
BDBClocation not on record	3
Salzburg, AT	2
Göteborg, SE	1
Copenhagen, DK	1
Guatemala City, GT	1
Gijón, ES	1
Royal Botanic Gardens, Kewlocation not on record	1
Denver, US	1
Olocation not on record	1

19 institutions · 185 of 219 vouchered records shown · 34 without an institution code

09Environmental DNA4 detections

Where the DNA of Phylloporus pelletieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.60 °C 4.90–8.40

Seasonal swing summer↔winter15.5 °C

Max temp (day)7.00 °C 6.70–10.6

Min temp (night)4.00 °C 2.90–6.40

Precipitation65.0 mm/mo 54.3–67.6

Air humidity66.1 % 66.0–66.6

Moisture balance33.6 mm/mo

Vapour deficit310 Pa 291–374

Wind speed5.30 m/s

Cloud cover54.2 % 52.2–54.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phylloporus pelletieri

At a glance

Sources11 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 311 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 311 records