Phylloporus arenicola

A.H.Sm. & Trappe · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Boletales/Boletaceae/Phylloporus

At a glance

Occurrence records634

Data sources8

Biological traits0

DNA specimens2

eDNA detections1

Sources8 archives

Databases and archives Phylloporus arenicola's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility634 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF634 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈39 Mbp

01Narrative

Phylloporus arenicola is a species of bolete mushroom in the family Boletaceae. It is found in the Pacific Northwest region of western North America, where it grows in sand dunes in a mycorrhizal association with pine trees. It is one of only three North American Boletaceae species that occur in coastal sand dunes.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phylloporus arenicola has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV791503.1 ↗675 bpUSA · 2024

ACGT

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAATTAAATGTGATGGGCGG …

Phylloporus arenicola isolate CA FUNDIS iNaturalist #256935342 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Phylloporus arenicola carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈39 181 303 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Phylloporus arenicola0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type634 records

Wild obs. + sensor619

Museum / vouchered15

Range

Area of Occupancy AOO1 712 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 282≤1 km 88≤10 km 78>10 km 74

522 georeferenced · 97 without coordinates

Open the mapobservation + sensor619

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 4≤10 km 3>10 km 1

8 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	4
Chicago, US	2
Santa Cruz, US	2
Research Collection of Steve Nesslocation not on record	1
Bronx, US	1
Ann Arbor, US	1
Denver, US	1
ILLSlocation not on record	1
California State University, East Baylocation not on record	1

9 institutions · 14 of 15 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Phylloporus arenicola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 10.2–10.2

Seasonal swing summer↔winter6.40 °C

Max temp (day)11.6 °C

Min temp (night)8.70 °C

Precipitation384 mm/mo

Air humidity66.7 %

Vapour deficit411 Pa

Cloud cover57.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)