Phyllophora crispa

(Hudson) P.S.Dixon · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Gigartinales/Phyllophoraceae/Phyllophora

At a glance

Occurrence records9 342

Data sources10

Biological traits2

DNA specimens107

eDNA detections79

Sources10 archives

Databases and archives Phyllophora crispa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 639 records↗

OBISOcean Biodiversity Information System4 703 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics107 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF · OBIS9 342 records

Environmental DNA1 datasets · 5 countries79 detections

DNA & barcodingBOLD · NCBI107 specimens

01Narrative

Phyllophora crispa is a medium-sized fleshy, marine red alga. This alga forms dense mats of up to 15 cm thickness, which influence environmental factors, thus creating habitat for several associated organisms.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition7 compounds

Compounds documented for Phyllophora crispa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavones3

Aminoacids1

Cholestane steroids1

Amarylidaceae alkaloids $ Phenylethylamines1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
1-Pentanaminium, 5-amino-1,5-dicarboxy-N,N,N-trimethyl-, inner salt	present	LOTUS
7''-O-Methylsciadopitysin	present	NPASS
CFPJAFNVQKSAMP-KAYWLYCHSA-N	present	NPASS
Cholesterol	present	LOTUS
Heveaflavone	present	NPASS
Hordenine	present	LOTUS
Podocarpusflavone B	present	NPASS

05DNA & barcoding107 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllophora crispa has left across the world's sequence archives.

At a glance

DNA specimens107

BINs1

Marker genes5

GenBank sequences4

eDNA detections79

The DNA barcodea real sequence read deposited for this species

ITSAF388621.1 ↗1 028 bpIreland

ACGT

GTCCGGTGAGGCCTTGGGGGGGATGGATAGACTGTGTTTCACGGACTATCTGGCCCGAACTTGGTCAAACCTTATCACTTAGAGGAAGGA …

Phyllophora crispa isolate 7.iii.93 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllophora pseudoceranoidessame genus8.3%Ozophora lanceolatasame family8.6%Coccotylus brodieisame family8.7%Erythrodermis trailliisame family9.0%Besa leptophyllasame family9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL3★ITS128S28S-D2

animal barcodeplant barcodefungal barcodemarker

08Occurrence & distribution

Record type9 342 records

Wild obs. + sensor2 972

Museum / vouchered3 967

Other2 403

Origin

Native170

Range

Area of Occupancy AOO8 112 km²

Depth

0–200 m sunlit1 901

200–1000 m twilight5

1–4 km midnight0

>4 km abyssal0

median 11.6 m · max 691.4 m · 1 906 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 2 521≤1 km 253≤10 km 74>10 km 4

2 852 georeferenced · 120 without coordinates

Open the mapobservation + sensor2 972

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 98≤1 km 195≤10 km 52>10 km 13

358 georeferenced · 3 609 without coordinates

Open the institutions mapphysical evidence3 967

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Francais pour l'Etude de la Merlocation not on record	487
486location not on record	320
Clocation not on record	166
South Kensington, GB	71
UAclocation not on record	50
Museum national d'Histoire naturellelocation not on record	31
MeiseBGlocation not on record	24
University of Stellenboschlocation not on record	20
LDlocation not on record	17
KMNlocation not on record	16
Ann Arbor, US	16
DASSHlocation not on record	12
Chapel Hill, US	11
Bronx, US	10
València, ES	8
PNHSlocation not on record	7
Universidad de Málagalocation not on record	6
SLU Artdatabankenlocation not on record	5
Universidad de Oviedolocation not on record	5
CJBGlocation not on record	4
Auckland, NZ	3
Madrid, ES	2
Barcelona, ES	2
Durham, US	1
GRAlocation not on record	1
BDBClocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Tampa, US	1
Acadia Universitylocation not on record	1
San Diego, US	1
CEFASlocation not on record	1
UIBlocation not on record	1
Paris, FR	1
Durham, US	1

34 institutions · 1 304 of 3 967 vouchered records shown · 179 without an institution code

09Environmental DNA79 detections

Where the DNA of Phyllophora crispa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found79

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 79 detections have coordinates

Open the map5 countries0

Black Sea

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 8.00–11.7

Seasonal swing summer↔winter8.60 °C

Max temp (day)10.1 °C 9.40–12.9

Min temp (night)7.70 °C 6.50–9.80

Precipitation75.8 mm/mo 53.1–95.5

Air humidity62.8 % 62.2–64.2

Moisture balance38.5 mm/mo

Vapour deficit423 Pa 399–497

Wind speed7.50 m/s

Cloud cover47.6 % 45.4–61.2

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Phyllophora crispa

At a glance

Sources10 archives

Habitat & environment2

Compound class profile4 classes

Documented compounds7 total

At a glance

Record type9 342 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 342 records