Phyllophaga cribrosa

(LeConte, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Scarabaeidae/Phyllophaga

At a glance

Occurrence records916

Data sources7

Biological traits0

DNA specimens10

eDNA detections7

Sources7 archives

Databases and archives Phyllophaga cribrosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility916 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF916 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD10 specimens

01Narrative

Phyllophaga cribrosa is a species of scarab beetle in the family Scarabaeidae. It is found in Central America and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllophaga cribrosa has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

40Gvariable

202Gvariable

316Gvariable

AACTTTGTACTTTCTTTTTGGTAGATGGGCAGGAATAGTGGGAACTTCTCTAAGTCTCCTAATTCGAGCTGAATTAGGCAACCCCGGGAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.30%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllophaga hirticulasame genus13.2%Phyllophaga lanceolatasame genus13.5%Phyllophaga arctasame genus13.7%Phyllophaga guanacastecasame genus14.0%Phyllophaga bipartitasame genus14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type916 records

Wild obs. + sensor725

Museum / vouchered191

Range

Area of Occupancy AOO2 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 416≤1 km 69≤10 km 23>10 km 81

589 georeferenced · 136 without coordinates

Open the mapobservation + sensor725

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 5≤1 km 12≤10 km 63>10 km 63

143 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lubbock, US	68
OSUClocation not on record	43
University of Alabamalocation not on record	28
ASUlocation not on record	22
US	12
Lexington, US	9
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
Albuquerque, US	1
University of Central Floridalocation not on record	1

10 institutions · 191 of 191 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Phyllophaga cribrosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–23.6

Seasonal swing summer↔winter19.3 °C

Max temp (day)30.6 °C

Min temp (night)17.8 °C

Precipitation55.1 mm/mo

Air humidity53.2 %

Moisture balance-130 mm/mo

Vapour deficit1,374 Pa

Wind speed4.20 m/s

Cloud cover28.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)