Phyllonorycter propinquinella

(Braun, 1908) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Phyllonorycter

At a glance

Occurrence records76

Data sources7

Biological traits0

DNA specimens57

eDNA detections62

Sources7 archives

Databases and archives Phyllonorycter propinquinella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI62 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 2 countries62 detections

DNA & barcodingBOLD57 specimens

01Narrative

The cherry blotch miner moth (Phyllonorycter propinquinella) is a moth of the family Gracillariidae. It is known from Canada (Québec and Nova Scotia) and the United States (Illinois, Ohio, Maine, Maryland, New York, Michigan, Vermont and Connecticut).Global Taxonomic Database of Gracillariidae (Lepidoptera) The wingspan is 8–9 mm. The larvae feed on Prunus serotina. They mine the leaves of their host plant. The mine has the form of a tentiform mine on the underside of the leaf.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllonorycter propinquinella has left across the world's sequence archives.

At a glance

DNA specimens57

BINs1

Marker genes1

eDNA detections62

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

73Amostly conserved

100Gmostly conserved

268Amostly conserved

298Amostly conserved

328Avariable

368Gmostly conserved

388Amostly conserved

496Gmostly conserved

595Cmostly conserved

628Avariable

646Cmostly conserved

AACTCTTTATTTTATTTTTGGAATTTGAGCAGGAATAATTGGATCCTCATTAAGAATTATAATTCGAGCTGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.60%

Haplotypes11

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllonorycter deschkaisame genus4.1%Phyllonorycter cydoniellasame genus4.4%Phyllonorycter ancepssame genus4.6%Phyllonorycter mespilellasame genus4.9%Phyllonorycter sorbicolasame genus5.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type76 records

Wild obs. + sensor21

Museum / vouchered55

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 6≤1 km 9≤10 km 2

17 georeferenced · 4 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 22

24 georeferenced · 31 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	23
Washington, US	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Smithsonian Institutionlocation not on record	3
New Haven, US	1
Biodiversity Institute of Ontariolocation not on record	1
Mississippi State, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

8 institutions · 46 of 55 vouchered records shown · 9 without an institution code

09Environmental DNA62 detections

Where the DNA of Phyllonorycter propinquinella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found62

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 62 detections have coordinates

Open the map2 countries0

Grassland1. Forest & Woodland|1.4. Temperate Forest14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 5.00–22.5

Seasonal swing summer↔winter24.4 °C

Max temp (day)19.4 °C 9.10–27.5

Min temp (night)7.80 °C 1.90–18.2

Precipitation93.3 mm/mo 77.8–117

Air humidity57.6 % 54.5–59.2

Moisture balance-14.4 mm/mo -64.5–19.4

Vapour deficit691 Pa 362–1,115

Wind speed3.30 m/s 2.50–5.40

Cloud cover42.1 % 36.9–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)