Phyllonorycter pastorella

(Zeller, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gracillariidae/Phyllonorycter

At a glance

Occurrence records530

Data sources7

Biological traits0

DNA specimens63

eDNA detections60

Sources7 archives

Databases and archives Phyllonorycter pastorella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility530 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics63 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF530 records

Environmental DNA1 datasets · 13 countries60 detections

DNA & barcodingBOLD63 specimens

01Narrative

Phyllonorycter pastorella is a moth of the family Gracillariidae. It is known from all of Europe (except the British Isles, Greece, Portugal, Denmark, Norway, Luxembourg and the Mediterranean islands), east to Russia, China and Japan. The wingspan is 8-9.5 mm. The larvae feed on Populus alba, Populus nigra, Salix alba, Salix babylonica, Salix fragilis, Salix lanata, Salix pentandra, Salix purpurea, Salix x sepulcralis, Salix triandra and Salix viminalis. They mine the leaves of their host plant. They create a large, lower-surface tentiform mine with one sharp fold. Pupation takes place within the mine in a cocoon. The frass is deposited in the opposite corner of the mine.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding63 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllonorycter pastorella has left across the world's sequence archives.

At a glance

DNA specimens63

BINs2

Marker genes1

eDNA detections60

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus58 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

100Amostly conserved

106Tmostly conserved

139Cvariable

157Cmostly conserved

181Gmostly conserved

187Cmostly conserved

217Amostly conserved

271Tvariable

280Cmostly conserved

313Tvariable

343Amostly conserved

346Tmostly conserved

347Tvariable

358Tmostly conserved

367Tmostly conserved

373Tvariable

386Cmostly conserved

391Amostly conserved

401Tmostly conserved

403Gvariable

466Avariable

523Tmostly conserved

529Tmostly conserved

542Tmostly conserved

619Amostly conserved

628Amostly conserved

646Tvariable

AACTCTTTATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGATCTTCTTTAAGAATTATAATTCGAGCAGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes21

BINs2

Most divergent pair5.8%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phyllonorycter comparellasame genus5.2%Phyllonorycter apparellasame genus5.3%Phyllonorycter erugatussame genus5.5%Phyllonorycter salicifoliellasame genus5.5%Phyllonorycter mildredaesame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type530 records

Wild obs. + sensor419

Museum / vouchered105

Other6

Origin

Native86

Range

Area of Occupancy AOO1 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 168≤1 km 86≤10 km 139>10 km 7

400 georeferenced · 19 without coordinates

Open the mapobservation + sensor419

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 8≤1 km 23≤10 km 8

39 georeferenced · 66 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	20
Tartu, EE	9
Iwate Prefectural Museumlocation not on record	6
Provincia di Livornolocation not on record	3
South Kensington, GB	3
Natural History Museum, Londonlocation not on record	2
PKlocation not on record	1
Oulu, FI	1
Sukachev Institute of Forest Siberian Branch of Russian Academy of Scienceslocation not on record	1
DanishLepidopterologicalSocietylocation not on record	1
Research Collection of Peter Lichtmanneckerlocation not on record	1
Research Collection of Hartmut Wegnerlocation not on record	1
MKlocation not on record	1
Senckenbergisches Institut und Museumlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

15 institutions · 52 of 105 vouchered records shown · 53 without an institution code

09Environmental DNA60 detections

Where the DNA of Phyllonorycter pastorella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map13 countries0

roadside along reservoirbotanical gardenswampy Alder forestcity parkUrban

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 3.40–19.8

Seasonal swing summer↔winter21.6 °C

Max temp (day)20.2 °C 5.50–24.2

Min temp (night)11.0 °C 0.9–14.8

Precipitation67.8 mm/mo 41.6–124

Air humidity59.8 % 56.4–65.8

Moisture balance-24.4 mm/mo -76.6–24.9

Vapour deficit728 Pa 339–980

Wind speed2.60 m/s 2.10–4.00

Cloud cover39.0 % 31.1–49.2

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)