Phyllodoce breweri

Plantae/Tracheophyta/Magnoliopsida/Ericales/Ericaceae/Phyllodoce

At a glance

Occurrence records2 781

Data sources9

Biological traits93

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Phyllodoce breweri's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 781 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources93 traits

Occurrence & distributionGBIF2 781 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Phyllodoce breweri is a species of flowering plant in the family Ericaceae known by the common names purple mountain heath and Brewer's mountain heather. It is native to California, where it can be found in mountain ranges including the southern Cascade Range, the San Bernardino Mountains, and the Sierra Nevada, its distribution extending into Nevada. It grows in rocky subalpine mountain habitat, such as slopes and meadows.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology4

Plant height0.3 m

⚠ sources differ — GIFT: 0.3 m · USDA: 0.305 m · TRY: 0.152 m

Seed mass0.012 mg

Seed mass max0.012 mg

Seed mass min0.012 mg

Life cycle & reproduction24

Bloom periodSummer

Coppice potentialYes

Deciduousnessevergreen

Flower colourpurple

Flower conspicuousYes

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDASlow

Life formsubshrub

Life spanperennial

Lifespan categoryModerate

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsYes

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateModerate

Diet & foraging1

Parasiteindependent

Habitat & environment24

Active growth periodSpring and Summer

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsNo

Aquaticterrestrial

BloatNone

Climatesubalpine or subarctic

Climberself-supporting

Epiphyteterrestrial

Foliage colorGreen

Foliage porosity summerPorous

Foliage porosity winterPorous

Foliage textureFine

Fruit colourgreen

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Subshrub, Shrub

Growth form USDARhizomatous

Hedge toleranceHigh

Known allelopathNo

Leaf retentionYes

Low growing grassNo

Root depth min6 in

Shape and orientationDecumbent

Small grainNo

Woodinesswoody

Physiology & chemistry20

Anaerobic toleranceNone

C:N ratioMedium

Caco3 toleranceNone

Cold stratification requiredYes

Drought toleranceNone

Fertility requirementLow

Fire resistantYes

Fire toleranceMedium

Frost free days min200 days

Moisture useHigh

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max60 in

Precipitation min40 in

Protein potentialMedium

Salinity toleranceNone

Shade toleranceMedium

Soil pH max7.5 pH

Soil pH min5.5 pH

Temperature min-3 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityContracting Only

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productYes

Palatable browse animalLow

Palatable graze animalLow

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicitySlight

Veneer productNo

Other traits6

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousNo

Fruit seed persistenceNo

Planting density max19 000 per acre

Planting density min1 200 per acre

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllodoce breweri has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSHM182009.1 ↗600 bp

ACGT

TCGAAACCTGCCAAGCAGAAAACTTGCGAACTTGTCTTATACAATGGGGAATGCGTGGGTTGGGCCTAGTCGTCATTCCTTCCGCTTTCC …

Phyllodoce breweri voucher INST Gillespie 06-019, WFU 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type2 781 records

Wild obs. + sensor2 374

Museum / vouchered407

Range

Area of Occupancy AOO3 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 385≤1 km 237≤10 km 136>10 km 92

1 850 georeferenced · 524 without coordinates

Open the mapobservation + sensor2 374

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 5≤1 km 219≤10 km 83>10 km 3

310 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence407

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions30 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Claremont, US	94
CASlocation not on record	36
Riverside, US	24
Santa Barbara, US	19
Los Angeles, US	16
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	14
Fredericton Stock Culture Collectionlocation not on record	10
Arcata, US	9
US	9
Angwin, US	8
Canadian Department of Agriculturelocation not on record	7
San Luis Obispo, US	6
Northridge, US	6
San Francisco, US	5
San Jose, US	5
Severin-McDaniel Insect Collectionlocation not on record	4
San Diego, US	4
Bronx, US	3
Logan, US	3
Fullerton, US	3
Madison, US	3
St. Paul, US	3
Phoenix, US	2
INFlocation not on record	2
Long Beach, US	2
Bloomington, US	2
Columbia, US	1
Bangkok, TH	1
Dekalb, US	1
Philadelphia, US	1
Henderson, US	1
Pullman, US	1
Davis, US	1
Flagstaff, US	1
Turlock, US	1
Ashland, US	1

36 institutions · 309 of 407 vouchered records shown · 98 without an institution code

09Environmental DNA1 detections

Where the DNA of Phyllodoce breweri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources9 archives

Size & morphology4

Life cycle & reproduction24

Diet & foraging1

Habitat & environment24

Physiology & chemistry20

Uses & economy14

Other traits6

At a glance

Record type2 781 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions30 of 36 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 781 records