Phyllis viscosa

Christ · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Phyllis

At a glance

Occurrence records80

Data sources6

Biological traits23

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Phyllis viscosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility80 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources23 traits

Occurrence & distributionGBIF80 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Phyllis viscosa is like Phyllis nobla but smaller with narrow, sticky leaves and short, dense inflorescence.Wild Flowers of the Canary Islands, by David Bramwell MSc., PhD., Zoë I. Bramwell BSc. Stanley Thornes (Publishers) Ltd, London and Burford, 1974.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology6

Fruit length max25 mm

Fruit length min25 mm

Leaf length max30 mm

Leaf length min20 mm

Plant height max0.8 m

Plant height min0.2 m

Life cycle & reproduction6

Flower colouryellow

Flowering endJun

Flowering startMar

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatesubtropical

Climberself-supporting

Elevation max1 000 m

Elevation min200 m

Epiphyteterrestrial

Growth formshrub

Leaf formlinear

Woodinesswoody

Other traits2

Inflorescencepanicle

Leaf arrangementopposite

05DNA & barcoding6 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllis viscosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMN124960.1 ↗308 bpSpain · 1994

ACGT

AAGGAGAAGTCGTAACAAGGTTTCCGAGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAAACGCCGCAACATGTTAATAACGCCTGG …

Phyllis viscosa voucher Kull (STU) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllis viscosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · kew

CCDB · kew — Kiehn M. 1986. Karyosystematische Untersuchungen und DNA-Messungen an Rubiaceae und ihre Bedeutung für die Systematik dieser Familie. Ph. D. Thesis. Universität Wien.

08Occurrence & distribution

Record type80 records

Wild obs. + sensor71

Museum / vouchered9

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 31≤1 km 9≤10 km 24

64 georeferenced · 7 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
BRNUlocation not on record	1
Moscow State Universitylocation not on record	1
WAGlocation not on record	1
Saint Louis, US	1
MeiseBGlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

7 institutions · 7 of 9 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)