Phyllanthus urinaria
speciesAt a glance
Occurrence records10 419
Data sources13
Biological traits49
DNA specimens40
eDNA detections30
Sources13 archives
Databases and archives Phyllanthus urinaria's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility10 419 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics40 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources49 traits
Chemical compositionLOTUS · NPASS71 compounds
Occurrence & distributionGBIF10 419 records
Environmental DNA1 datasets · 5 countries30 detections
DNA & barcodingBOLD · NCBI40 specimens
Genome at a glanceCCDB2n = 52
01Narrative
コミカンソウはコミカンソウ科コミカンソウ属の一年草。別名キツネノチャブクロ（狐の茶袋）。従来の分類ではトウダイグサ科に入れていた。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology22
Fruit length2.25 mm
Fruit width3.5 mm
⚠ sources differ — AusTraits: 3.5 mm · GIFT: 1.5 mm
Fruit width max2 mm
Fruit width min1 mm
Leaf length10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 7 mm
Leaf length max18 mm
Leaf length min4 mm
Leaf width4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 3.5 mm
Leaf width max9 mm
Leaf width min1.5 mm
Plant height0.475 m
⚠ sources differ — GIFT: 0.475 m · AusTraits: 0.3 m
Plant height max1 m
Plant height min0 m
Seed length2 mm
Seed length max1.3 mm
Seed mass0.26 mg
Seed mass max0.26 mg
Seed mass min0.26 mg
Seed volume0.68 mm³
Seed volume max0.68 mm³
Seed volume min0.68 mm³
Seed width max1 mm
Life cycle & reproduction8
Deciduousnessevergreen
Flower colouryellow
Flowering timenyyyyynnnnnn
Life formannual or subshrub
Life spanannual
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typemonoecious
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 300 m
Elevation mean800 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica, Campo de Altitude, Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta de Terra Firme, Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesssimple
Leaf shapenarrowly_lanceolate narrowly_oblong obovate
Mycorrhiza type0.00000264
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Shoot orientationascending
03Chemical composition71 compounds
Compounds documented for Phyllanthus urinaria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Arylnaphthalene and aryltetralin lignans12
Flavonols7
Dibenzylbutane lignans7
Gallotannins7
Simple phenolic acids5
Documented compounds71 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+/-)-Hypophyllanthin | present | LOTUS | |
| (-)-Nirtetralin | present | LOTUS | |
| (1,2,2,14,15,16,19,20,21,35,36-Undecahydroxy-3,6,11,24,32-pentaoxo-7,10,25,28,31,40-hexaoxaoctacyclo[35.2.1.05,39.08,27.09,30.012,17.018,23.033,38]tetraconta-4,12,14,16,18,20,22,33,35,37-decaen-29-yl) 3,4,5-trihydroxybenzoate | present | LOTUS | |
| (3S,4S)-4-(1,3-benzodioxol-5-ylmethyl)-3-[(3,4-dimethoxyphenyl)methyl]oxolan-2-one | present | LOTUS | |
| (57R,58S,510R,511R,519S)-14,15,16,24,25,26,52,53,516,517,517-Undecahydroxy-55,513,515,3,8-pentaoxo-55,57,58,510,511,513,515,516,517,517a-decahydro-4,7-dioxa-5(19,10)-1,16-epoxy-7,11-methanodibenzo[i,k][1,4,7]trioxacyclotridecina-1,2(1,2)-dibenzenacyclooctaphane-58-yl 3,4,5-trihydroxybenzoate | present | LOTUS | |
| (6R,7aS)-6-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-7,7a-dihydro-6H-1-benzofuran-2-one | present | LOTUS | |
| (E)-3-(3-carbamimidoyl-4-hydroxyphenyl)prop-2-enoic acid | present | LOTUS | |
| (S)-8-Hydroxy-3-(3-hydroxy-4-methoxyphenyl)isochroman-1-one | present | NPASS | |
| 1-O-[(2R)-2,5-dimethylhexyl] 2-O-[(2S)-2,5-dimethylhexyl] benzene-1,2-dicarboxylate | present | LOTUS | |
| 2(3H)-Furanone, 3,4-bis(1,3-benzodioxol-5-ylmethyl)dihydro-, (3S,4S)- | present | LOTUS |
05DNA & barcoding40 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus urinaria has left across the world's sequence archives.
At a glance
DNA specimens40
Marker genes6
GenBank sequences10
eDNA detections30
Countries8
The DNA barcodea real sequence read deposited for this species
CTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCTTCGGGTCGAGGGCACGTCTGCCTGGG …
Emblica urinaria voucher MC217 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Phyllanthus urinaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Ploidypolyploid inferred
Chromosome records14–1002n range50median52mode9records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 523×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · Cave1958
CCDB · ipcn-api-dl — Sarkar, A. K. & N. Datta. 1980. Cytological assessment of the family Euphorbiaceae. II. Tribe Phyllantheae. Proc. Indian Sci. Congr. Assoc. (III, C) 67: 48–49.
CCDB · book-indian_vol1 — Raghavan, R.S. & Arora, C.M. 1958; Webster, G.L. & Ellis, J.R. 1962 ; Datta, N. 1967; Gill, B.S., Chawla, A. & Kanwal, R. 1973 ; Sarkar, A.K. & Datta, N. 1980
CCDB · Cave1958 — Raghavan & Arora 1958
2n 502×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rossignol, L., M. Rossignol & R. Haicour. 1987. A systematic revision of Phyllanthus subsection Urinaria (Euphorbiaceae). Amer. J. Bot. 74(12): 1853–1862.
2n 141×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Chuang, T.I. et al. 1963
2n 241×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Kothari, N. M., C. A. Ninant & P. I. Kuriachan. 1981a. In Chromosome number reports LXXI. Taxon 30: 511–512.
2n 261×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Huang, S. f., Y. q. Wang, Z. y. Chen & X. h. Shi. 1988. Plant chromosome counts (4). Subtrop. Forest Sci. Technol. 16: 25–30.
2n 1001×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Rossignol, L., M. Rossignol & R. Haicour. 1987. A systematic revision of Phyllanthus subsection Urinaria (Euphorbiaceae). Amer. J. Bot. 74(12): 1853–1862.
n 264×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1
CCDB · ipcn-api-dl — Kothari, N. M., C. A. Ninant & P. I. Kuriachan. 1981a. In Chromosome number reports LXXI. Taxon 30: 511–512.
CCDB · book-ipcn67-71 — DATTA, N. 1967. In IOPB chromosome number reports XII. Taxon 16: 341-350-:-
CCDB · book-ipcn73-74 — GILL, B.S., A. CHAWLA, & R. KANWAL. North-West Indian Euphorbiaceae. Cytologia 38: 393-401. I I
CCDB · Cave1962 — Webster & Ellis 1962
n 71×CCDB · Cave1963
CCDB · Cave1963 — Chuang et al. 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type10 419 records
Wild obs. + sensor8 003
Museum / vouchered2 344
Other72
Origin
Native4
Range
Area of Occupancy AOO25 512 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy81% within 1 km
≤100 m 4 666≤1 km 367≤10 km 731>10 km 458
6 222 georeferenced · 1 781 without coordinates
Open the mapobservation + sensor8 003
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy54% within 1 km
≤100 m 70≤1 km 67≤10 km 77>10 km 38
252 georeferenced · 2 092 without coordinates
Open the institutions mapphysical evidence2 344
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions116 of 225 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 194 |
| Beijing, CN | 161 |
| Guangzhou, CN | 104 |
| Chicago, US | 81 |
| Kunming, CN | 80 |
| National Biodiversity Institute, Costa Ricalocation not on record | 79 |
| Bronx, US | 77 |
| Tampa, US | 60 |
| Odawara, JP | 55 |
| Guilin, CN | 54 |
| Taipei, TW | 47 |
| University of Stellenboschlocation not on record | 47 |
| Kew, GB | 46 |
| Chengdu, CN | 41 |
| Nanjing, CN | 38 |
| Fort Worth, US | 33 |
| Durham, US | 32 |
| Central China Normal Universitylocation not on record | 29 |
| Guangzhou, CN | 29 |
| Brisbane, AU | 26 |
| Yangling, CN | 24 |
| Baroda, IN | 24 |
| Wuhan, CN | 24 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 23 |
| Xiamen, CN | 20 |
| Canberra, AU | 20 |
| Austin, US | 18 |
| San José, CR | 18 |
| Columbia, US | 18 |
| Chiba, JP | 17 |
| Taipei, TW | 16 |
| Jena Microbial Resource Collectionlocation not on record | 16 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 16 |
| Miami, US | 16 |
| Paris, FR | 15 |
| US | 14 |
| Université de Strasbourglocation not on record | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 13 |
| Changsha, CN | 13 |
| Madison, US | 13 |
| Sanda, JP | 12 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 11 |
| Chapel Hill, US | 11 |
| Chengdu, CN | 11 |
| Nagasaki University - Fisherieslocation not on record | 10 |
| Honolulu, US | 10 |
| Anhui Normal Universitylocation not on record | 10 |
| Valdosta State Universitylocation not on record | 10 |
| Hangzhou, CN | 10 |
| Durango, MX | 10 |
| Seoul, KR | 9 |
| AUAlocation not on record | 9 |
| Chongqing Museumlocation not on record | 9 |
| Southwest Forestry Collegelocation not on record | 9 |
| CASlocation not on record | 9 |
| BISHlocation not on record | 8 |
| Dehra Dun, IN | 8 |
| Armidale, AU | 8 |
| MeiseBGlocation not on record | 8 |
| Brasília, BR | 8 |
| Sagamihara, JP | 8 |
| Mexico City, MX | 8 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 8 |
| LBVlocation not on record | 8 |
| Smithfield, AU | 8 |
| Awka, NG | 7 |
| Herbier National du Gabonlocation not on record | 7 |
| Mérida, MX | 7 |
| Kensington, AU | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| WAGlocation not on record | 7 |
| Blumenau, BR | 6 |
| Bangkok, TH | 6 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 6 |
| Zhejiang Universitylocation not on record | 6 |
| MAlocation not on record | 6 |
| Universidad de Antioquia (UdeA)location not on record | 6 |
| TNMlocation not on record | 5 |
| Guiyang, CN | 5 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| Zhejiang Museum of Natural Historylocation not on record | 5 |
| León, NI | 5 |
| Cambridge, US | 5 |
| FJFClocation not on record | 5 |
| CNF-UFHBlocation not on record | 5 |
| Monastir, TN | 5 |
| Tall Timbers Research Stationlocation not on record | 5 |
| GAlocation not on record | 5 |
| Universidad Nacional de Colombia (UNAL)location not on record | 5 |
| Edinburgh, GB | 5 |
| National Institute of Biological Resourceslocation not on record | 4 |
| 云南省思茅市民族传统医药研究所location not on record | 4 |
| Jishou Universitylocation not on record | 4 |
| FJIDClocation not on record | 4 |
| KOMlocation not on record | 4 |
| Yaoundé, CM | 4 |
| Knoxville, US | 4 |
| Clemson, US | 4 |
| TAIElocation not on record | 4 |
| Nanjing, CN | 4 |
| Université du Lomélocation not on record | 4 |
| Museu Paraense Emílio Goeldilocation not on record | 4 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 4 |
| Xian, CN | 4 |
| Little Rock, US | 4 |
| Museo universitario di Chietilocation not on record | 3 |
| Calabar, NG | 3 |
| Davis, US | 3 |
| Yunnan Universitylocation not on record | 3 |
| Phoenix, US | 3 |
| EL PASO, US | 3 |
| Zhuzhou, CN | 3 |
| COLlocation not on record | 3 |
| Mlocation not on record | 3 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 3 |
| Philadelphia, US | 3 |
| Altos de Pipe, VE | 3 |
| Riverside, US | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Shanghai, CN | 3 |
| Wuhan, CN | 3 |
| MAPRlocation not on record | 2 |
| MEXUlocation not on record | 2 |
| Xinxiang, CN | 2 |
| Mississippi State, US | 2 |
| QCNElocation not on record | 2 |
| Ann Arbor, US | 2 |
| Austin, US | 2 |
| Zhengzhou, CN | 2 |
| Plocation not on record | 2 |
| Claremont, US | 2 |
| Dekalb, US | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Jiujiang Forestry Institutelocation not on record | 2 |
| Stockholm, SE | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| James Cook Townsvillelocation not on record | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Shenzhen, CN | 2 |
| Kyoto Universitylocation not on record | 2 |
| Ilhéus, BR | 2 |
| La Selva Biological Station, Organization for Tropical Studieslocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Due West, US | 2 |
| Christchurch, NZ | 2 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 2 |
| Zürich, CH | 2 |
| Brussels, BE | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Seychelles National Herbariumlocation not on record | 2 |
| IPHAMETRAlocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Guiyang, CN | 1 |
| Lanzhou, CN | 1 |
| Pretoria, ZA | 1 |
| UFMSlocation not on record | 1 |
| GB | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Wuzhou, CN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| EAlocation not on record | 1 |
| Elocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Aarhus, DK | 1 |
| Cibinong, ID | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Fundación Estación Biológica Guayacanallocation not on record | 1 |
| Boise, US | 1 |
| Shanghai, CN | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Vancouver, CA | 1 |
| HUAlocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Llocation not on record | 1 |
| Chapingo, MX | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| ENTClocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Xian, CN | 1 |
| Tempe, US | 1 |
| GMBAlocation not on record | 1 |
| Mount Annan, AU | 1 |
| LDlocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Toronto, CA | 1 |
| DEAL Martiniquelocation not on record | 1 |
| Chengdu, CN | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Uppsala, SE | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Williamsburg, US | 1 |
| Minia, EG | 1 |
| Fayetteville, US | 1 |
| ASUlocation not on record | 1 |
| College Park, US | 1 |
| University of Port Harcourtlocation not on record | 1 |
| Dirección Nacional Forestal, Ministerio de Agricultura y Ganaderíalocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| BGPAlocation not on record | 1 |
| Guatemala City, GT | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Wlocation not on record | 1 |
| CJBGlocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Beijing, CN | 1 |
| Guiyang, CN | 1 |
| Universidade Federal de Juiz de Foralocation not on record | 1 |
| Bloomington, US | 1 |
| Taipei, TW | 1 |
| Burlington, US | 1 |
| Tuscaloosa, US | 1 |
| Auckland, NZ | 1 |
| McWane Science Centerlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| UNESClocation not on record | 1 |
225 institutions · 2 280 of 2 344 vouchered records shown · 62 without an institution code
09Environmental DNA30 detections
Where the DNA of Phyllanthus urinaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found30
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 30 detections have coordinates
Open the map5 countries0
FieldGrasslandroad side weed
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median26.1 °C 17.9–27.9
Seasonal swing summer↔winter2.70 °C
Max temp (day)29.5 °C 21.2–30.6
Min temp (night)22.6 °C 14.2–24.9
Precipitation235 mm/mo 101–280
Air humidity67.5 % 57.7–70.8
Moisture balance73.2 mm/mo -20.3–133
Vapour deficit1,080 Pa 781–1,249
Wind speed2.50 m/s 1.20–3.80
Cloud cover37.2 % 23.4–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.