Phyllanthus tenellus
Roxb. · speciesAt a glance
Occurrence records7 257
Data sources13
Biological traits47
DNA specimens10
eDNA detections9
Sources13 archives
Databases and archives Phyllanthus tenellus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 257 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics10 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS · NPASS58 compounds
Occurrence & distributionGBIF7 257 records
Environmental DNA1 datasets · 2 countries9 detections
DNA & barcodingBOLD · NCBI10 specimens
Genome at a glanceCCDB · GIFT2n = 26
01Narrative
Phyllanthus tenellus, le Petit tamarin ou le Phyllanthe grêle, est une espèce de plantes herbacées dicotylédones, de la famille des Phyllanthacées. Elle fait partie des plantes sauvages que l'on trouve le long des bords de route, terrains abandonnés et jardins.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsGIFTTRY
Size & morphology17
Fruit length1.5 mm
Fruit width1.75 mm
Fruit width max1.9 mm
Fruit width min1.7 mm
Leaf length15.5 mm
Leaf length max25 mm
Leaf length min6 mm
Leaf width6 mm
Leaf width max11 mm
Leaf width min2 mm
Plant height0.5 m
Plant height max0.5 m
Plant height min0.2 m
Seed length1 mm
Seed length max1 mm
Seed length min0.8 mm
Seed mass0.13 mg
Life cycle & reproduction13
Dehiscencedehiscent
Dispersal typeunspecialized
Flowering endJul
Flowering startMay
Flowering timeyyyyyynnnnnn
Life formannual
Life spanannual perennial
⚠ sources differ — AusTraits: annual perennial · GIFT: annual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Self fertilizationabsent
Sex typemonoecious
⚠ sources differ — AusTraits: monoecious · GIFT: bisexual
Diet & foraging1
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourgreen
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb shrub · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Cerrado (lato sensu), Floresta Ciliar ou Galeria, Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesssimple
Leaf formelliptic
Leaf shapeelliptical obovate
Woodinessnon-woody
Other traits1
Seeds per fruit101-1000
03Chemical composition58 compounds
Compounds documented for Phyllanthus tenellus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cucurbitane triterpenoids17
Iridoids monoterpenoids12
Flavonols3
Gallotannins2
Monosaccharides2
Documented compounds58 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,4S,5S,6S,7R,11S)-2,10-dioxatricyclo[5.3.1.04,11]undecane-4,5,6-triol | present | NPASS | |
| (1S,4aR,5S,6S,7R,7aS)-7-(hydroxymethyl)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-5,6,7-triol | present | NPASS | |
| (2R)-2,6-dihydroxy-6-methyl-2-[(2S,3R,8R,9R,10S,13R,14S,16R,17R)-2,3,16-trihydroxy-4,4,9,13,14-pentamethyl-2,3,7,8,10,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]heptan-3-one | present | NPASS | |
| (2R)-2-[(2S,3R,8R,9R,10S,13R,14S,16R,17R)-3,16-dihydroxy-4,4,9,13,14-pentamethyl-2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,7,8,10,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]-2-hydroxy-6-methylhept-5-en-3-one | present | NPASS | |
| (2S,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2S,3R,8R,9R,10R,13R,14S,16R,17R)-17-[(E,2R)-2,6-dihydroxy-6-methyl-3-oxohept-4-en-2-yl]-3,16-dihydroxy-4,4,9,13,14-pentamethyl-2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one | present | NPASS | |
| (2S,8S,9R,10R,13R,14S,16R,17R)-17-[(2R,3S)-2,3-dihydroxy-6-methylhept-5-en-2-yl]-16-hydroxy-4,4,9,13,14-pentamethyl-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,7,8,10,12,15,16,17-octahydro-1H-cyclopenta[a]phenanthrene-3,11-dione | present | NPASS | |
| -D-Glucopyranoside, (1aS,1bS,2S,5aR,6S,6aS)-1a,1b,2,5a,6,6a-hexahydro-6-hydroxy-1a-[[[(2E)-1-oxo-3-phenyl-2-propenyl]oxy]methyl]oxireno[4,5]cyclopenta[1,2-c]pyran-2-yl | present | NPASS | |
| 1-[(2S,3R,8R,9R,10S,13R,14S,16R,17R)-3,16-dihydroxy-4,4,9,13,14-pentamethyl-2-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,7,8,10,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethanone | present | NPASS | |
| 6-O-trans-Feruloylcatalpol | present | NPASS |
05DNA & barcoding10 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus tenellus has left across the world's sequence archives.
At a glance
DNA specimens10
Marker genes4
GenBank sequences10
eDNA detections9
Countries5
The DNA barcodea real sequence read deposited for this species
GAACGCAAGTTGCGCCCGAAGCCTTTTGGTCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCTCCCTCACTCCCTCACTCGAGGCA …
Phyllanthus tenellus voucher RRCBI-hm006 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT
The complete instruction manual Phyllanthus tenellus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidy2× diploid · measured
Chromosome records26–262n range26median26mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 263×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Krishnappa, D. G. & R. V. Reshme. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 597–598.
CCDB · book-ipcn73-74 — BANCILHON, L. 1971. Contribution a !'etude taxonomique du genre Phyllanthus (Euphorbiacees). Boissiera 18:1-81,
GIFT · GIFT (floras)
n 133×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — BRUNEL, J. F. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · book-ipcn66 — Miller&Webster 1966
CCDB · book-ipcn75-78 — Brunel 1977
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type7 257 records
Wild obs. + sensor6 035
Museum / vouchered1 177
Other45
Origin
Native221
Introduced238
Range
Area of Occupancy AOO16 888 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 3 609≤1 km 412≤10 km 348>10 km 306
4 675 georeferenced · 1 360 without coordinates
Open the mapobservation + sensor6 035
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy62% within 1 km
≤100 m 123≤1 km 62≤10 km 70>10 km 42
297 georeferenced · 880 without coordinates
Open the institutions mapphysical evidence1 177
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions89 of 186 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Brisbane, AU | 72 |
| Odawara, JP | 57 |
| Tampa, US | 52 |
| UNESP-ISlocation not on record | 39 |
| Mount Annan, AU | 39 |
| Saint Louis, US | 32 |
| Kochi, JP | 30 |
| Bronx, US | 28 |
| Smithfield, AU | 26 |
| Blumenau, BR | 22 |
| Brasília, BR | 22 |
| Miami, US | 20 |
| Chiba, JP | 20 |
| TAIElocation not on record | 19 |
| Canberra, AU | 18 |
| Paris, FR | 17 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 17 |
| Armidale, AU | 17 |
| Kew, GB | 15 |
| National Biodiversity Institute, Costa Ricalocation not on record | 15 |
| Museo Entomologico de Leonlocation not on record | 14 |
| Honolulu, US | 14 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 12 |
| Sagamihara, JP | 12 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 12 |
| BISHlocation not on record | 12 |
| Kensington, AU | 11 |
| UnBlocation not on record | 11 |
| Nishihara, JP | 11 |
| Jena Microbial Resource Collectionlocation not on record | 11 |
| Osaka, JP | 10 |
| University of Stellenboschlocation not on record | 10 |
| Fort Worth, US | 10 |
| BIO-UNIPIlocation not on record | 9 |
| Plocation not on record | 9 |
| Columbia, US | 8 |
| UFMSlocation not on record | 8 |
| Departamento de Sistematica e Ecologialocation not on record | 8 |
| IPA/SPlocation not on record | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| UNESClocation not on record | 7 |
| Auckland, NZ | 6 |
| Criciúma, BR | 6 |
| Antiguo Cuscatlán, SV | 6 |
| Madison, US | 6 |
| Millersville, US | 6 |
| Laboratorio de Ictiologialocation not on record | 6 |
| Ivano-Frankivsk, UA | 6 |
| Kawasaki Shi Tama Ku, JP | 6 |
| Tomioka, JP | 6 |
| Feira de Santana, BR | 6 |
| GAlocation not on record | 6 |
| Corrientes, AR | 6 |
| Universidade Federal de Goiáslocation not on record | 6 |
| Valdosta State Universitylocation not on record | 5 |
| Bangkok, TH | 5 |
| Brasília, BR | 5 |
| Universidad de Caldas (UCaldas)location not on record | 5 |
| USP-IBlocation not on record | 5 |
| Masindi, UG | 5 |
| Tuscaloosa, US | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Austin, US | 5 |
| INMAlocation not on record | 5 |
| UTFPR-CPlocation not on record | 4 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 4 |
| Bando, JP | 4 |
| Sendai, JP | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| Durango, MX | 4 |
| UNICAMPlocation not on record | 4 |
| UEMlocation not on record | 4 |
| Maringá, BR | 4 |
| CJBGlocation not on record | 4 |
| FUVATESlocation not on record | 4 |
| Chicago, US | 4 |
| Taipei, TW | 4 |
| Fukushima Universitylocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| UFMGlocation not on record | 3 |
| UNEMATlocation not on record | 3 |
| Kagoshima, JP | 3 |
| Salvador, BR | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| Santa Teresa, BR | 3 |
| Berlin, DE | 3 |
| UFRRJlocation not on record | 3 |
| Campo Mourão, BR | 3 |
| Wuzhou, CN | 3 |
| Glocation not on record | 3 |
| UFESlocation not on record | 3 |
| Chapel Hill, US | 3 |
| San José, CR | 3 |
| Tsukuba, JP | 3 |
| Christchurch, NZ | 3 |
| Nishihara, JP | 2 |
| Knoxville, US | 2 |
| Universidade Federale do Rio Grande do Sullocation not on record | 2 |
| KURAlocation not on record | 2 |
| UFBAlocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| Baroda, IN | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Dekalb, US | 2 |
| Fortaleza, BR | 2 |
| CASlocation not on record | 2 |
| Sanda, JP | 2 |
| Wellington, NZ | 2 |
| Little Rock, US | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Foz do Iguaçu, BR | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 2 |
| Davis, US | 2 |
| AUAlocation not on record | 2 |
| UFPElocation not on record | 2 |
| JP | 2 |
| BDBClocation not on record | 2 |
| IAPlocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| UDESC-CAVlocation not on record | 2 |
| Universidade Federal do Maranhãolocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Cascavel, BR | 2 |
| UFSMlocation not on record | 2 |
| CEPLAClocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Toyama, JP | 1 |
| Taipei, TW | 1 |
| UFABClocation not on record | 1 |
| Jackson, US | 1 |
| Université du Lomélocation not on record | 1 |
| Londrina, BR | 1 |
| UERJlocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| UFOPlocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Burlington, US | 1 |
| New Haven, US | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Philadelphia, US | 1 |
| Hobart, AU | 1 |
| Williamsburg, US | 1 |
| JBRJlocation not on record | 1 |
| Frankfurt am Main | 1 |
| US | 1 |
| BClocation not on record | 1 |
| Mérida, MX | 1 |
| Clemson, US | 1 |
| HUENFlocation not on record | 1 |
| Florida Museum of Natural Historylocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Pelotas, BR | 1 |
| James Cook Townsvillelocation not on record | 1 |
| Seropédica, BR | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| WTUlocation not on record | 1 |
| ASUlocation not on record | 1 |
| EL PASO, US | 1 |
| Riverside, US | 1 |
| OTSlocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Guangzhou, CN | 1 |
| Gump Stationlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| UNESP-RClocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| UFSClocation not on record | 1 |
| Ilhéus, BR | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
186 institutions · 1 153 of 1 177 vouchered records shown · 21 without an institution code
09Environmental DNA9 detections
Where the DNA of Phyllanthus tenellus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found9
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 9 detections have coordinates
Open the map2 countries0
Weed in flower beds, gardens, roadsides
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 15.4–18.2
Seasonal swing summer↔winter15.3 °C
Max temp (day)20.5 °C 20.5–21.7
Min temp (night)10.4 °C 10.4–13.9
Precipitation70.4 mm/mo 70.4–277
Air humidity57.7 % 57.7–64.2
Moisture balance-28.0 mm/mo -28.0–177
Vapour deficit804 Pa 761–804
Wind speed2.90 m/s 1.30–2.90
Cloud cover41.2 % 41.2–46.5
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.