Phyllanthus revaughanii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records4

Data sources8

Biological traits9

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Phyllanthus revaughanii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF4 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Phyllanthus revaughanii is a species of flowering plant in the family Phyllanthaceae, native to the Mascarene Islands and the Mozambique Channel Islands (Europa Island, Juan de Nova Island). Its natural habitat is rocky shores.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus revaughanii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSKX689324.1 ↗390 bp

ACGT

TTTGAACGCAAGTTGCGCCCAAAGCCTTCGGGCTGAGGGCACGTCTGCCTGGGTGTCACGCATCGTCGCTCCCTCCCAACAATTCCAATA …

Nellica revaughanii isolate PHRE1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Phyllanthus revaughanii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 131×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 records

Wild obs. + sensor2

Museum / vouchered2

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.