Phyllanthus pulcher

Wall. ex Müll.Arg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records75

Data sources8

Biological traits25

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Phyllanthus pulcher's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility75 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF75 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaTgenome

01Narrative

云桂叶下珠（学名：）为大戟科叶下珠属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit width3 mm

Fruit width max3 mm

Fruit width min3 mm

Leaf length24 mm

Leaf length max30 mm

Leaf length min18 mm

Leaf width10.5 mm

Leaf width max13 mm

Leaf width min8 mm

Plant height1 m

Plant height max1.5 m

Plant height min0.5 m

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 760 m

Elevation mean1 230 m

Elevation min700 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus pulcher has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMN916040.1 ↗613 bpChina

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAACTGCAGAATGACCCGCGAACAAGTTTATTCACTGCGGAAGGGTGCC …

Phyllanthus pulcher voucher Bouman & Yong RWB066 (HITBC) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Phyllanthus pulcher carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidypolyploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type75 records

Wild obs. + sensor38

Museum / vouchered36

Other1

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 12≤1 km 5≤10 km 4>10 km 5

26 georeferenced · 12 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2>10 km 1

3 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	6
Beijing, CN	4
Honolulu, US	2
BISHlocation not on record	2
Guangzhou, CN	2
Bronx, US	2
Xiamen, CN	2
Kew, GB	2
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	1
Feira de Santana, BR	1
Chongqing Museumlocation not on record	1
UEPAlocation not on record	1
Claremont, US	1
Laboratorio de Ictiologialocation not on record	1

14 institutions · 28 of 36 vouchered records shown · 8 without an institution code

09Environmental DNA3 detections

Where the DNA of Phyllanthus pulcher was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)