Phyllanthus niruri
speciesAt a glance
Occurrence records3 389
Data sources13
Biological traits23
DNA specimens16
eDNA detections17
Sources13 archives
Databases and archives Phyllanthus niruri's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 389 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics16 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources23 traits
Chemical compositionLOTUS · NPASS108 compounds
Occurrence & distributionGBIF3 389 records
Environmental DNA1 datasets · 2 countries17 detections
DNA & barcodingBOLD · NCBI16 specimens
Genome at a glanceCCDB2n = 26
01Narrative
Phyllanthus niruri est une espèce de plantes à fleurs de la famille des Phyllanthaceae. Elle croît dans les zones côtières des régions tropicales. Elle est proche des euphorbes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology2
Plant height0.3 m
Plant height max0.457 m
Life cycle & reproduction7
Deciduousnessevergreen
Dispersal typeself
Flowering endOct
Flowering startSep
Life formannual
Life spanannual
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatewet tropical
Climberself-supporting
Elevation max3 000 m
Elevation mean1 880 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campinarana, Campo de Várzea, Campo Limpo, Cerrado (lato sensu), Floresta Ombrófila (= Floresta Pluvial), Restinga
Mycorrhiza type0.000000415
Succulenceno
Woodinessnon-woody
Physiology & chemistry1
Nitrogen fixingnon_nitrogen_fixer
03Chemical composition108 compounds
Compounds documented for Phyllanthus niruri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Gallotannins15
Arylnaphthalene and aryltetralin lignans14
Dibenzylbutane lignans13
Flavonols13
Flavan-3-ols7
Documented compounds108 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+/-)-Hypophyllanthin | present | LOTUS | |
| (-)-Nirtetralin | present | LOTUS | |
| (1R)-7,8,9-trihydroxy-3,5-dioxo-1,2-dihydrocyclopenta[c]isochromene-1-carboxylic acid | present | LOTUS | |
| (1R,8R,11S,13R)-11-methoxy-2-oxa-9-azatetracyclo[6.5.1.01,5.09,13]tetradeca-4,6-dien-3-one | present | LOTUS | |
| (1S,2R,3R)-1-(3,4-dimethoxyphenyl)-6,7-dimethoxy-2,3-bis(methoxymethyl)-1,2,3,4-tetrahydronaphthalene | present | LOTUS | |
| (1S,2R,4R,8S)-4-Methoxy-14-oxa-7-azatetracyclo[6.6.1.01,11.02,7]pentadeca-9,11-dien-13-one | present | LOTUS | |
| (1S,2R,7R,14S)-14-hydroxy-12-oxa-6-azatetracyclo[5.5.2.01,9.02,6]tetradec-9-en-11-one | present | LOTUS | |
| (1S,2S,7R,14R)-14-hydroxy-12-oxa-6-azatetracyclo[5.5.2.01,9.02,6]tetradec-9-en-11-one | present | LOTUS | |
| (2R)-2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R)-6,7-dihydroxy-2-(4-hydroxyphenyl)-8-(3-methylbut-2-enyl)-5-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-[[(2R,3R,4S,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxymethyl]oxan-2-yl]oxy-2,3-dihydrochromen-4-one | present | LOTUS |
05DNA & barcoding16 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus niruri has left across the world's sequence archives.
At a glance
DNA specimens16
Marker genes3
GenBank sequences10
eDNA detections17
Countries4
The DNA barcodea real sequence read deposited for this species
AGAGCACATCACAAAACGCGGGTTATGCGATACTTGGTGTGAATGCATATCAATAAGCGGAGGATTTATGCGATACTTGGTGTGAATTGC …
Phyllanthus niruri voucher SCRIPCOGSA95 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL2★ITS6
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Phyllanthus niruri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidydiploid inferred
Chromosome records14–362n range26median26mode10records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 266×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +1
CCDB · ipcn-api-dl — Trivedi, R. N., S. Mukherjee & M. P. Trivedi. 1986. Reproductive behaviour in the genus Phyllanthus (Euphorbiaceae). Proc. Indian Sci. Congr. Assoc. 73(3–VI): 149.
CCDB · ipcn-api-dl — Kothari, N. M., C. A. Ninant & P. I. Kuriachan. 1981a. In Chromosome number reports LXXI. Taxon 30: 511–512.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · book-ipcn67-71 — CHAMPAULT, A. 1970. Etude caryosystematique et ecologique de quelques Euphorbiacees herbacees et arbustives africaines. Bull. Seo. Bot. France 117: 137-168.
CCDB · book-indian_vol1 — Raghavan, R.S. 1957 ; Chuang, T.I. et a!. 1963 ; Champault, A. 1970; Bir, S.S. & Sidhu, M. 1980
CCDB · Cave1957 — Raghavan
2n 142×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1
CCDB · book-ipcn67-71 — HSU, C.-c. 1967. Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania No. 13: 117-130.
CCDB · book-indian_vol1 — Hsu, C.-C. 1967
2n 281×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Sharma, A.K. & Jash, M. 1958c
2n 361×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — BANCILHON, L. 1971. Contribution a !'etude taxonomique du genre Phyllanthus (Euphorbiacees). Boissiera 18:1-81,
n 133×CCDB · ipcn-api-dl · CCDB · Cave1963
CCDB · ipcn-api-dl — Trivedi, R. N., S. Mukherjee & M. P. Trivedi. 1986. Reproductive behaviour in the genus Phyllanthus (Euphorbiaceae). Proc. Indian Sci. Congr. Assoc. 73(3–VI): 149.
CCDB · ipcn-api-dl — Trivedi, M. P. & R. N. Trivedi. 1992. Chromosomal behaviour in weeds. Glimpses Cytogenet. India 3: 188–198.
CCDB · Cave1963 — Chuang et al. 1963
n 181×CCDB · book-ipcn66
CCDB · book-ipcn66 — Miller&Webster 1966
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 389 records
Wild obs. + sensor533
Museum / vouchered2 854
Other2
Origin
Native498
Range
Area of Occupancy AOO7 564 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 184≤1 km 91≤10 km 14>10 km 18
307 georeferenced · 226 without coordinates
Open the mapobservation + sensor533
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy69% within 1 km
≤100 m 236≤1 km 62≤10 km 104>10 km 32
434 georeferenced · 2 420 without coordinates
Open the institutions mapphysical evidence2 854
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions105 of 235 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Chicago, US | 332 |
| Saint Louis, US | 301 |
| Durango, MX | 155 |
| Bronx, US | 142 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 95 |
| National Biodiversity Institute, Costa Ricalocation not on record | 88 |
| Mexico City, MX | 56 |
| Blumenau, BR | 52 |
| Laboratorio de Ictiologialocation not on record | 52 |
| Austin, US | 44 |
| Feira de Santana, BR | 37 |
| JBRJlocation not on record | 36 |
| Corrientes, AR | 36 |
| Salvador, BR | 35 |
| Instituto do Meio Ambientelocation not on record | 29 |
| University of Stellenboschlocation not on record | 29 |
| Universidad Nacional de Colombia (UNAL)location not on record | 28 |
| Antiguo Cuscatlán, SV | 27 |
| Kew, GB | 27 |
| Madison, US | 26 |
| San Isidro, AR | 26 |
| Baroda, IN | 24 |
| UFMGlocation not on record | 23 |
| IPA/SPlocation not on record | 22 |
| UNIVASFlocation not on record | 20 |
| Paleontological Collectionlocation not on record | 20 |
| Universidad Nacional de Asunciónlocation not on record | 19 |
| Universidad de Antioquia (UdeA)location not on record | 19 |
| Chaguaramas, TT | 17 |
| UFBAlocation not on record | 17 |
| Tuxtla Gutiérrez, MX | 17 |
| Córdoba, AR | 17 |
| USP-IBlocation not on record | 17 |
| UNICAMPlocation not on record | 16 |
| San José, CR | 16 |
| Centre de Recherche en Sciences Naturelles (CRSN/Lwiro)location not on record | 16 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 15 |
| Taipei, TW | 15 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 14 |
| Guangzhou, CN | 14 |
| Ivano-Frankivsk, UA | 14 |
| UnBlocation not on record | 13 |
| UTFPR-CPlocation not on record | 13 |
| Beijing, CN | 12 |
| MeiseBGlocation not on record | 12 |
| Masindi, UG | 11 |
| Universidad de Caldas (UCaldas)location not on record | 11 |
| Tuxtla Gutiérrez, MX | 11 |
| PUC-RSlocation not on record | 11 |
| Campo Mourão, BR | 11 |
| UNESClocation not on record | 10 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 10 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 10 |
| Davis, US | 10 |
| Jena Microbial Resource Collectionlocation not on record | 10 |
| Ann Arbor, US | 10 |
| Kunming, CN | 10 |
| Cascavel, BR | 10 |
| Criciúma, BR | 10 |
| Universidad del Valle (UV)location not on record | 10 |
| Culiacán, MX | 10 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 9 |
| Ilhéus, BR | 9 |
| Museu Paraense Emílio Goeldilocation not on record | 9 |
| León, NI | 9 |
| Guilin, CN | 9 |
| ESALQlocation not on record | 8 |
| Foz do Iguaçu, BR | 8 |
| MEXUlocation not on record | 8 |
| Cuiabá, BR | 8 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 8 |
| Berlin, DE | 8 |
| CEPLAClocation not on record | 8 |
| UFESlocation not on record | 8 |
| Universidade Federal do Maranhãolocation not on record | 7 |
| Cenargenlocation not on record | 7 |
| La Paz, BO | 7 |
| Xiamen, CN | 7 |
| Uberlândia, BR | 7 |
| CASlocation not on record | 7 |
| UFRPElocation not on record | 7 |
| Londrina, BR | 7 |
| UNESP-FCAlocation not on record | 7 |
| Tapachula, MX | 7 |
| Nanjing, CN | 7 |
| Lake Charles, US | 6 |
| Riverside, US | 6 |
| UEMlocation not on record | 6 |
| Federal University of Espírito Santolocation not on record | 6 |
| Universidade Federal de Sergipe (UFS)location not on record | 6 |
| Sucre, BO | 6 |
| UESBlocation not on record | 5 |
| ASUlocation not on record | 5 |
| UFPIlocation not on record | 5 |
| Brasília, BR | 5 |
| Canberra, AU | 5 |
| UFMSlocation not on record | 5 |
| Tampa, US | 5 |
| Leiden University Medical Centerlocation not on record | 5 |
| Cochabamba, BO | 5 |
| Maringá, BR | 5 |
| Durham, US | 5 |
| UEPAlocation not on record | 5 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| HUAlocation not on record | 4 |
| Bogotá, D.C., CO | 4 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 4 |
| UFSMlocation not on record | 4 |
| UEMAlocation not on record | 4 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 4 |
| UFABClocation not on record | 4 |
| Moscow State Universitylocation not on record | 4 |
| Austin, US | 4 |
| FUVATESlocation not on record | 4 |
| Paris, FR | 4 |
| Fortaleza, BR | 4 |
| UFOPlocation not on record | 4 |
| Chongqing Museumlocation not on record | 4 |
| Philadelphia, US | 3 |
| Autlán de Navarro, MX | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| URCAlocation not on record | 3 |
| UFSClocation not on record | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| UNIVILLElocation not on record | 3 |
| Fort Worth, US | 3 |
| Wellington, NZ | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Frankfurt am Main | 3 |
| HNBlocation not on record | 3 |
| Nanjing, CN | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| QCNElocation not on record | 3 |
| QAUlocation not on record | 3 |
| Juriquilla, MX | 2 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 2 |
| UTFPR-DVlocation not on record | 2 |
| Brasília, BR | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Stockholm, SE | 2 |
| Miami, US | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Cambridge, US | 2 |
| COLlocation not on record | 2 |
| Badajoz, ES | 2 |
| Burlington, US | 2 |
| Guangzhou, CN | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Aarhus, DK | 2 |
| Bloomington, US | 2 |
| CPATSAlocation not on record | 2 |
| Guatemala City, GT | 2 |
| UNESP-RClocation not on record | 2 |
| UFVJMlocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Kathmandu, NP | 2 |
| UFERSAlocation not on record | 2 |
| Auckland, NZ | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 2 |
| Lanzhou, CN | 2 |
| MAlocation not on record | 2 |
| UNEMATlocation not on record | 2 |
| Dehra Dun, IN | 2 |
| Chengdu, CN | 2 |
| Wuhan, CN | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| South Kensington, GB | 2 |
| Porto Velho, BR | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| UNESP-IBILCElocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Guangxi Agricultural Universitylocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| CHAPAlocation not on record | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| INMAlocation not on record | 1 |
| Tsukuba, JP | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Yangling, CN | 1 |
| UNICAPlocation not on record | 1 |
| Nishihara, JP | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| San Francisco, US | 1 |
| UFSJlocation not on record | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| GAlocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Castelar, AR | 1 |
| Arequipa, PE | 1 |
| Tlalnepantla, MX | 1 |
| Angwin, US | 1 |
| INBIOlocation not on record | 1 |
| Taipei, TW | 1 |
| QAPlocation not on record | 1 |
| Honolulu, US | 1 |
| CJBGlocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| TULVlocation not on record | 1 |
| Calabar, NG | 1 |
| Puebla, MX | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Mlocation not on record | 1 |
| MAPRlocation not on record | 1 |
| Mérida, MX | 1 |
| OTSlocation not on record | 1 |
| Nishihara, JP | 1 |
| Claremont, US | 1 |
| HACAMlocation not on record | 1 |
| HUENFlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Bangkok, TH | 1 |
| BISHlocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Lubbock, US | 1 |
| MUFALlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| University of Papua New Guinealocation not on record | 1 |
| CNF-UFHBlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| UFPElocation not on record | 1 |
| Brisbane, AU | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
235 institutions · 2 753 of 2 854 vouchered records shown · 100 without an institution code
09Environmental DNA17 detections
Where the DNA of Phyllanthus niruri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map2 countries0
Garden
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.0 °C 12.4–27.2
Seasonal swing summer↔winter14.6 °C
Max temp (day)29.6 °C 18.5–30.8
Min temp (night)14.5 °C 5.40–22.9
Precipitation13.8 mm/mo 3.10–182
Air humidity47.0 % 45.9–60.4
Moisture balance-95.2 mm/mo -109–43.0
Vapour deficit1,396 Pa 941–1,402
Wind speed3.60 m/s 2.70–4.30
Cloud cover19.6 % 14.7–23.2
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.