Phyllanthus myrtifolius

(Wight) Müll.Arg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Phyllanthaceae/Phyllanthus

At a glance

Occurrence records77

Data sources8

Biological traits23

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Phyllanthus myrtifolius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Phyllanthus myrtifolius (лат.) — вид двудольных растений рода Филлантус (Phyllanthus) семейства Филлантовые (Phyllanthus). Впервые был описан в 1852 году Робертом Уайтом под названием Macraea myrtifolia, в род Phyllanthus вид в 1866 году поместил швейцарский ботаник Иоганнес Мюллер Ааргауский.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology13

Fruit length2 mm

Fruit length max2 mm

Fruit length min2 mm

Fruit width3 mm

Fruit width max3 mm

Fruit width min3 mm

Leaf length14 mm

Leaf length max16 mm

Leaf length min12 mm

Leaf width4 mm

Leaf width max4.5 mm

Leaf width min3.5 mm

Plant height0.5 m

Life cycle & reproduction3

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition26 compounds

Compounds documented for Phyllanthus myrtifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Arylnaphthalene and aryltetralin lignans16

Gallotannins7

Apotirucallane triterpenoids $ Limonoids4

Multiflorane triterpenoids2

Taraxerane triterpenoids1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(1,2,2,14,15,16,19,20,21,35,36-Undecahydroxy-3,6,11,24,32-pentaoxo-7,10,25,28,31,40-hexaoxaoctacyclo[35.2.1.05,39.08,27.09,30.012,17.018,23.033,38]tetraconta-4,12,14,16,18,20,22,33,35,37-decaen-29-yl) 3,4,5-trihydroxybenzoate	present	LOTUS
9-(1,3-benzodioxol-5-yl)-3,5,6,7-tetramethoxy-3H-benzo[f][2]benzofuran-1-one	present	LOTUS
9-(3,4-Dimethoxy-phenyl)-8-H-furo(3',4':6,7)naphtho(2,3-d)(1,3)dioxol-6-one	present	LOTUS
[(1R,2R,4S,5S,6S,10R,11S,12R,15R,16R,18S,19R)-4,18-diacetyloxy-16-hydroxy-1,5,10,15-tetramethyl-6-[(3R)-5-oxooxolan-3-yl]-13-oxapentacyclo[10.6.1.02,10.05,9.015,19]nonadec-8-en-11-yl] (E)-2-methylbut-2-enoate	present	NPASS
[(1R,2R,4S,5S,6S,10R,11S,12R,15R,16R,18S,19R)-4,18-diacetyloxy-16-hydroxy-1,5,10,15-tetramethyl-6-[(3R)-5-oxooxolan-3-yl]-13-oxapentacyclo[10.6.1.02,10.05,9.015,19]nonadec-8-en-11-yl] (E)-3,4-dimethylpent-2-enoate	present	NPASS
[(1R,2R,4S,5S,6S,10R,11S,12R,15R,16R,18S,19R)-4,18-diacetyloxy-16-hydroxy-1,5,10,15-tetramethyl-6-[(3R)-5-oxooxolan-3-yl]-13-oxapentacyclo[10.6.1.02,10.05,9.015,19]nonadec-8-en-11-yl] benzoate	present	NPASS
[(1R,2R,4S,5S,6S,10R,11S,12R,15R,16R,18S,19R)-4,18-diacetyloxy-16-hydroxy-1,5,10,15-tetramethyl-6-[(3S)-5-oxooxolan-3-yl]-13-oxapentacyclo[10.6.1.02,10.05,9.015,19]nonadec-8-en-11-yl] (2R)-2-methylbutanoate	present	NPASS
[(1R,4S,8S,13R,14S,17R,22R)-4,9,9,14,17,20,20-heptamethyl-23-oxo-24-oxahexacyclo[11.9.2.01,14.04,13.05,10.017,22]tetracosa-5(10),11-dien-8-yl] 2-hydroxybenzoate	present	LOTUS
[(1R,4S,8S,13R,14S,17R,22R)-4,9,9,14,17,20,20-heptamethyl-23-oxo-24-oxahexacyclo[11.9.2.01,14.04,13.05,10.017,22]tetracosa-5(10),11-dien-8-yl] acetate	present	LOTUS
[(1R,4S,8S,13R,14S,17R,22R)-4,9,9,14,17,20,20-heptamethyl-23-oxo-24-oxahexacyclo[11.9.2.01,14.04,13.05,10.017,22]tetracosa-5(10),11-dien-8-yl] benzoate	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Phyllanthus myrtifolius has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMN915997.1 ↗635 bpSingapore

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACATGTTTATCGACCGCGGAAGGTGCCTG …

Cathetus myrtifolius voucher Yu 58 (L) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★ITS6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor68

Museum / vouchered9

Range

Area of Occupancy AOO232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 39≤1 km 10≤10 km 4>10 km 1

54 georeferenced · 14 without coordinates

Open the mapobservation + sensor68

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	2
Kew, GB	2
Beijing, CN	1
Claremont, US	1
Guangzhou, CN	1
Gump Stationlocation not on record	1

6 institutions · 8 of 9 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Phyllanthus myrtifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.9 °C 18.9–18.9

Seasonal swing summer↔winter9.90 °C

Max temp (day)22.0 °C

Min temp (night)14.7 °C

Precipitation328 mm/mo

Air humidity65.8 %

Moisture balance229 mm/mo

Vapour deficit751 Pa

Wind speed0.9 m/s

Cloud cover47.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)